\
| Variant ID: vg0824155625 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 24155625 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATTTTTCTTGTCGTTTCGGCTTCGATTACGCCTTTGCCGGTTCGCACAGTTGCGCCGGTTCGCAATCTTGAATCGCCTCCCACTATGGACCTTGCCAATC[A/G]
CAACGAACGAGAGGAGTAAACGACGCCTCACTTCTTTCTCTCGTGCGGTCGTGCCGGTTGACGCCTGCCGCGCCCCTGACCTAATTCTTTCTGGTAATTT
AAATTACCAGAAAGAATTAGGTCAGGGGCGCGGCAGGCGTCAACCGGCACGACCGCACGAGAGAAAGAAGTGAGGCGTCGTTTACTCCTCTCGTTCGTTG[T/C]
GATTGGCAAGGTCCATAGTGGGAGGCGATTCAAGATTGCGAACCGGCGCAACTGTGCGAACCGGCAAAGGCGTAATCGAAGCCGAAACGACAAGAAAAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.30% | 22.00% | 3.98% | 4.70% | NA |
| All Indica | 2759 | 90.60% | 1.80% | 3.59% | 3.95% | NA |
| All Japonica | 1512 | 46.20% | 53.40% | 0.33% | 0.07% | NA |
| Aus | 269 | 4.50% | 26.40% | 29.00% | 40.15% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 79.80% | 0.00% | 6.02% | 14.19% | NA |
| Indica III | 913 | 92.90% | 2.50% | 2.96% | 1.64% | NA |
| Indica Intermediate | 786 | 87.40% | 3.40% | 5.60% | 3.56% | NA |
| Temperate Japonica | 767 | 56.70% | 42.80% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 32.70% | 67.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.10% | 58.10% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 1.00% | 92.70% | 4.17% | 2.08% | NA |
| Intermediate | 90 | 71.10% | 24.40% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0824155625 | A -> G | LOC_Os08g38120.1 | upstream_gene_variant ; 1187.0bp to feature; MODIFIER | silent_mutation | Average:58.207; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| vg0824155625 | A -> G | LOC_Os08g38130.1 | downstream_gene_variant ; 2951.0bp to feature; MODIFIER | silent_mutation | Average:58.207; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| vg0824155625 | A -> G | LOC_Os08g38110-LOC_Os08g38120 | intergenic_region ; MODIFIER | silent_mutation | Average:58.207; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| vg0824155625 | A -> DEL | N | N | silent_mutation | Average:58.207; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0824155625 | 1.29E-06 | 1.17E-18 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0824155625 | NA | 1.29E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824155625 | 1.28E-06 | NA | mr1789 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0824155625 | NA | 1.52E-08 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |