\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824108010:

Variant ID: vg0824108010 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 24108010
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACCATAGCTAGAGGCCACCCGCGTTGCAATGCATATTCCACATACCATCTCCACACTCGAGAGTTTTGAACTGGCATTAGTTCCCAATAAAAACCCTCA[A/G]
TTGCCCGACTTACTATAACATTGATTGTTATGTCACTTGTCTGTGGATCAACTCTCAAGCCCCTCATTAACTATCCTTTTATAGAAGGTACACTCCTCTC

Reverse complement sequence

GAGAGGAGTGTACCTTCTATAAAAGGATAGTTAATGAGGGGCTTGAGAGTTGATCCACAGACAAGTGACATAACAATCAATGTTATAGTAAGTCGGGCAA[T/C]
TGAGGGTTTTTATTGGGAACTAATGCCAGTTCAAAACTCTCGAGTGTGGAGATGGTATGTGGAATATGCATTGCAACGCGGGTGGCCTCTAGCTATGGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.60% 0.40% 8.06% 0.00% NA
All Indica  2759 92.80% 0.40% 6.85% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 29.40% 3.00% 67.66% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 80.00% 0.40% 19.57% 0.00% NA
Indica III  913 95.80% 0.40% 3.72% 0.00% NA
Indica Intermediate  786 91.30% 0.50% 8.14% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 0.00% 5.21% 0.00% NA
Intermediate  90 96.70% 0.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0824108010 A -> G LOC_Os08g38050.1 missense_variant ; p.Ile246Thr; MODERATE nonsynonymous_codon ; I246T Average:67.864; most accessible tissue: Zhenshan97 flag leaf, score: 90.355 unknown unknown TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0824108010 A G 0.01 -0.01 -0.01 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0824108010 NA 1.71E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824108010 NA 4.50E-07 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824108010 NA 9.00E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824108010 NA 2.00E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824108010 NA 9.23E-18 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824108010 NA 3.28E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824108010 NA 3.24E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824108010 NA 2.54E-10 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824108010 NA 1.96E-06 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824108010 NA 6.17E-06 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824108010 NA 1.10E-09 mr1188_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824108010 NA 9.77E-06 mr1364_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824108010 NA 3.40E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824108010 NA 1.23E-10 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824108010 NA 8.27E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251