\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824104348:

Variant ID: vg0824104348 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 24104348
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCGGTGCCTGGCGTAGAGGTCTTTAGTGCTCGCAACGTGGGCCTGCTGCTCCAAGGGAGCGAAGGTGACCCTAGTATGGGTGCGTGGCTGGTACTAGC[G/A]
TAGGTAGGCCTGGTACACCTCCTCGGTGTGTGGCTCTCCCTCGTGCTCCACGACCTCCTCGGTTGCGAGCAACCAGTCCTCAACAAAAGTCCCCAACTTG

Reverse complement sequence

CAAGTTGGGGACTTTTGTTGAGGACTGGTTGCTCGCAACCGAGGAGGTCGTGGAGCACGAGGGAGAGCCACACACCGAGGAGGTGTACCAGGCCTACCTA[C/T]
GCTAGTACCAGCCACGCACCCATACTAGGGTCACCTTCGCTCCCTTGGAGCAGCAGGCCCACGTTGCGAGCACTAAAGACCTCTACGCCAGGCACCGCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 12.50% 0.74% 0.00% NA
All Indica  2759 98.30% 1.60% 0.04% 0.00% NA
All Japonica  1512 67.50% 30.50% 1.98% 0.00% NA
Aus  269 76.60% 22.30% 1.12% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 2.90% 0.13% 0.00% NA
Temperate Japonica  767 77.80% 18.90% 3.26% 0.00% NA
Tropical Japonica  504 45.60% 53.60% 0.79% 0.00% NA
Japonica Intermediate  241 80.50% 19.10% 0.41% 0.00% NA
VI/Aromatic  96 86.50% 12.50% 1.04% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0824104348 G -> A LOC_Os08g38050.1 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:74.887; most accessible tissue: Minghui63 young leaf, score: 93.394 N N N N
vg0824104348 G -> A LOC_Os08g38040.1 intron_variant ; MODIFIER silent_mutation Average:74.887; most accessible tissue: Minghui63 young leaf, score: 93.394 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0824104348 G A -0.01 -0.02 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0824104348 5.99E-16 4.27E-20 Awn_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0824104348 8.41E-11 3.91E-12 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0824104348 NA 4.56E-07 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251