\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824007713:

Variant ID: vg0824007713 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 24007713
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTTCTCTCATCTCTTTAAGTGATAGGGTTGGCAATCTCTGCTCAGCGATAGGGATTGAATAGTTTCATTAAACATATAATAATTGAATAATCTCTGCAT[C/T]
GCGTCTGGGACGAAGGAGATCGCCACTGGTCTGGCCCGCGTGGAGGCACTTTTCTGCTTATGCCGCCGCGGTGTTGTGTCCGGGCAGGAGACCCCACTGG

Reverse complement sequence

CCAGTGGGGTCTCCTGCCCGGACACAACACCGCGGCGGCATAAGCAGAAAAGTGCCTCCACGCGGGCCAGACCAGTGGCGATCTCCTTCGTCCCAGACGC[G/A]
ATGCAGAGATTATTCAATTATTATATGTTTAATGAAACTATTCAATCCCTATCGCTGAGCAGAGATTGCCAACCCTATCACTTAAAGAGATGAGAGAACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.70% 3.00% 0.34% 0.00% NA
All Indica  2759 94.30% 5.10% 0.54% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 81.00% 17.00% 2.02% 0.00% NA
Indica II  465 95.90% 3.90% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.80% 2.90% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0824007713 C -> T LOC_Os08g37904.1 intron_variant ; MODIFIER silent_mutation Average:78.841; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N
vg0824007713 C -> T LOC_Os08g37904.4 intron_variant ; MODIFIER silent_mutation Average:78.841; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N
vg0824007713 C -> T LOC_Os08g37904.6 intron_variant ; MODIFIER silent_mutation Average:78.841; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N
vg0824007713 C -> T LOC_Os08g37904.3 intron_variant ; MODIFIER silent_mutation Average:78.841; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N
vg0824007713 C -> T LOC_Os08g37904.2 intron_variant ; MODIFIER silent_mutation Average:78.841; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N
vg0824007713 C -> T LOC_Os08g37904.5 intron_variant ; MODIFIER silent_mutation Average:78.841; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0824007713 C T -0.21 -0.06 -0.04 -0.04 -0.06 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0824007713 NA 9.28E-06 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824007713 NA 2.41E-08 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824007713 NA 8.52E-08 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824007713 NA 9.21E-12 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824007713 NA 8.07E-10 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824007713 NA 2.24E-06 mr1020_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824007713 NA 1.55E-12 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824007713 NA 8.86E-11 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824007713 NA 7.35E-15 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824007713 NA 2.54E-13 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824007713 NA 5.87E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824007713 NA 9.78E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251