\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0823855479:

Variant ID: vg0823855479 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 23855479
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGAGGAGATTACTGTTGTTAAATTAAGAGTAAATTGTATTGGTGGTATACAAACTTGTTAGGTGGGTGCAATTTAGTATATAAACTTATAAAATGCTCG[T/C]
TTTCAGTACACAAACTTGTCTAGTTCATGCGAACGAGGACCAAAATAACTTGACAATGTTAATTTTATAAAGTTGATGTTGATTAGGATGTGGCGTGTAT

Reverse complement sequence

ATACACGCCACATCCTAATCAACATCAACTTTATAAAATTAACATTGTCAAGTTATTTTGGTCCTCGTTCGCATGAACTAGACAAGTTTGTGTACTGAAA[A/G]
CGAGCATTTTATAAGTTTATATACTAAATTGCACCCACCTAACAAGTTTGTATACCACCAATACAATTTACTCTTAATTTAACAACAGTAATCTCCTCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 2.60% 0.32% 0.00% NA
All Indica  2759 99.90% 0.10% 0.04% 0.00% NA
All Japonica  1512 91.40% 7.80% 0.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 97.80% 1.70% 0.52% 0.00% NA
Tropical Japonica  504 81.00% 17.50% 1.59% 0.00% NA
Japonica Intermediate  241 92.90% 7.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 4.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0823855479 T -> C LOC_Os08g37650.1 upstream_gene_variant ; 2559.0bp to feature; MODIFIER silent_mutation Average:59.536; most accessible tissue: Minghui63 root, score: 80.366 N N N N
vg0823855479 T -> C LOC_Os08g37660.1 upstream_gene_variant ; 1000.0bp to feature; MODIFIER silent_mutation Average:59.536; most accessible tissue: Minghui63 root, score: 80.366 N N N N
vg0823855479 T -> C LOC_Os08g37650.2 upstream_gene_variant ; 2606.0bp to feature; MODIFIER silent_mutation Average:59.536; most accessible tissue: Minghui63 root, score: 80.366 N N N N
vg0823855479 T -> C LOC_Os08g37670.1 downstream_gene_variant ; 3198.0bp to feature; MODIFIER silent_mutation Average:59.536; most accessible tissue: Minghui63 root, score: 80.366 N N N N
vg0823855479 T -> C LOC_Os08g37660-LOC_Os08g37670 intergenic_region ; MODIFIER silent_mutation Average:59.536; most accessible tissue: Minghui63 root, score: 80.366 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0823855479 NA 9.90E-16 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823855479 NA 6.97E-12 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823855479 NA 7.80E-10 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823855479 2.24E-06 6.16E-21 mr1769_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823855479 NA 1.80E-06 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251