Variant ID: vg0823855479 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 23855479 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGGAGGAGATTACTGTTGTTAAATTAAGAGTAAATTGTATTGGTGGTATACAAACTTGTTAGGTGGGTGCAATTTAGTATATAAACTTATAAAATGCTCG[T/C]
TTTCAGTACACAAACTTGTCTAGTTCATGCGAACGAGGACCAAAATAACTTGACAATGTTAATTTTATAAAGTTGATGTTGATTAGGATGTGGCGTGTAT
ATACACGCCACATCCTAATCAACATCAACTTTATAAAATTAACATTGTCAAGTTATTTTGGTCCTCGTTCGCATGAACTAGACAAGTTTGTGTACTGAAA[A/G]
CGAGCATTTTATAAGTTTATATACTAAATTGCACCCACCTAACAAGTTTGTATACCACCAATACAATTTACTCTTAATTTAACAACAGTAATCTCCTCCT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.10% | 2.60% | 0.32% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 91.40% | 7.80% | 0.79% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 97.80% | 1.70% | 0.52% | 0.00% | NA |
Tropical Japonica | 504 | 81.00% | 17.50% | 1.59% | 0.00% | NA |
Japonica Intermediate | 241 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 93.30% | 4.40% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0823855479 | T -> C | LOC_Os08g37650.1 | upstream_gene_variant ; 2559.0bp to feature; MODIFIER | silent_mutation | Average:59.536; most accessible tissue: Minghui63 root, score: 80.366 | N | N | N | N |
vg0823855479 | T -> C | LOC_Os08g37660.1 | upstream_gene_variant ; 1000.0bp to feature; MODIFIER | silent_mutation | Average:59.536; most accessible tissue: Minghui63 root, score: 80.366 | N | N | N | N |
vg0823855479 | T -> C | LOC_Os08g37650.2 | upstream_gene_variant ; 2606.0bp to feature; MODIFIER | silent_mutation | Average:59.536; most accessible tissue: Minghui63 root, score: 80.366 | N | N | N | N |
vg0823855479 | T -> C | LOC_Os08g37670.1 | downstream_gene_variant ; 3198.0bp to feature; MODIFIER | silent_mutation | Average:59.536; most accessible tissue: Minghui63 root, score: 80.366 | N | N | N | N |
vg0823855479 | T -> C | LOC_Os08g37660-LOC_Os08g37670 | intergenic_region ; MODIFIER | silent_mutation | Average:59.536; most accessible tissue: Minghui63 root, score: 80.366 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0823855479 | NA | 9.90E-16 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823855479 | NA | 6.97E-12 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823855479 | NA | 7.80E-10 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823855479 | 2.24E-06 | 6.16E-21 | mr1769_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823855479 | NA | 1.80E-06 | mr1951_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |