\
| Variant ID: vg0823822394 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 23822394 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 241. )
TAATGGATCTTTCCTTGTGCAAAAGTCAGCAATGCAGAAGAAGAATATGCTATTTATTTTACAAAAAAAGAAAAGAAAATTTTCAATCATGTTGAACATT[T/C]
TACCAACAGAAAGTGAAACATCTCCATAATCATGATTCATAATTTGAAAACCTGGGTTGATTCCGGATTGACAAAAACGTGTTCAGAGGAAAATGCTAAA
TTTAGCATTTTCCTCTGAACACGTTTTTGTCAATCCGGAATCAACCCAGGTTTTCAAATTATGAATCATGATTATGGAGATGTTTCACTTTCTGTTGGTA[A/G]
AATGTTCAACATGATTGAAAATTTTCTTTTCTTTTTTTGTAAAATAAATAGCATATTCTTCTTCTGCATTGCTGACTTTTGCACAAGGAAAGATCCATTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.70% | 9.10% | 6.22% | 0.00% | NA |
| All Indica | 2759 | 93.30% | 1.40% | 5.22% | 0.00% | NA |
| All Japonica | 1512 | 66.00% | 25.30% | 8.73% | 0.00% | NA |
| Aus | 269 | 95.90% | 0.70% | 3.35% | 0.00% | NA |
| Indica I | 595 | 84.00% | 3.40% | 12.61% | 0.00% | NA |
| Indica II | 465 | 95.10% | 2.20% | 2.80% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.00% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 92.40% | 1.30% | 6.36% | 0.00% | NA |
| Temperate Japonica | 767 | 44.50% | 42.50% | 13.04% | 0.00% | NA |
| Tropical Japonica | 504 | 94.60% | 2.20% | 3.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.70% | 18.70% | 6.64% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 7.80% | 8.89% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0823822394 | T -> C | LOC_Os08g37595.1 | downstream_gene_variant ; 2422.0bp to feature; MODIFIER | silent_mutation | Average:43.374; most accessible tissue: Callus, score: 64.059 | N | N | N | N |
| vg0823822394 | T -> C | LOC_Os08g37600.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.374; most accessible tissue: Callus, score: 64.059 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0823822394 | NA | 2.59E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823822394 | NA | 1.68E-07 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823822394 | NA | 4.72E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823822394 | NA | 3.62E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823822394 | NA | 5.17E-07 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823822394 | NA | 6.21E-07 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823822394 | NA | 3.51E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823822394 | NA | 6.42E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823822394 | NA | 6.04E-08 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823822394 | NA | 6.04E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823822394 | 1.96E-06 | NA | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823822394 | NA | 5.30E-09 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823822394 | 1.50E-06 | 7.09E-08 | mr1955 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |