\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0823786747:

Variant ID: vg0823786747 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 23786747
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCTAGATCCGAGAGTAAGGTCTCTTGGTTGCGCGTTTTCACAACCAAGTCATCAACATAGGCCTCAACATTACGTCCTATTTGGCTACCCAAAGAAATT[T/C]
GAGTAGTACGTTGAAAAGTAGGACCTGCATTGTTTAGCCCGAAAGGCATTGTCGTATAACAATAAGTTCCTATGGGGGTTATGAATGCAGTTTTTTCCTC

Reverse complement sequence

GAGGAAAAAACTGCATTCATAACCCCCATAGGAACTTATTGTTATACGACAATGCCTTTCGGGCTAAACAATGCAGGTCCTACTTTTCAACGTACTACTC[A/G]
AATTTCTTTGGGTAGCCAAATAGGACGTAATGTTGAGGCCTATGTTGATGACTTGGTTGTGAAAACGCGCAACCAAGAGACCTTACTCTCGGATCTAGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 11.20% 6.20% 0.19% NA
All Indica  2759 92.50% 1.70% 5.47% 0.29% NA
All Japonica  1512 60.80% 31.20% 8.00% 0.00% NA
Aus  269 94.40% 0.70% 4.46% 0.37% NA
Indica I  595 83.00% 3.90% 13.11% 0.00% NA
Indica II  465 92.90% 1.70% 3.87% 1.51% NA
Indica III  913 99.30% 0.10% 0.55% 0.00% NA
Indica Intermediate  786 91.60% 1.90% 6.36% 0.13% NA
Temperate Japonica  767 40.80% 46.50% 12.65% 0.00% NA
Tropical Japonica  504 92.70% 4.40% 2.98% 0.00% NA
Japonica Intermediate  241 58.10% 38.20% 3.73% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 81.10% 10.00% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0823786747 T -> C LOC_Os08g37560.1 missense_variant ; p.Gln853Arg; MODERATE nonsynonymous_codon ; Q853R Average:32.928; most accessible tissue: Zhenshan97 flower, score: 49.187 unknown unknown TOLERATED 1.00
vg0823786747 T -> DEL LOC_Os08g37560.1 N frameshift_variant Average:32.928; most accessible tissue: Zhenshan97 flower, score: 49.187 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0823786747 NA 8.43E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823786747 NA 6.23E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823786747 NA 1.96E-07 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823786747 NA 1.51E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823786747 4.06E-06 4.05E-06 mr1494 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823786747 NA 8.93E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823786747 NA 1.97E-09 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823786747 NA 1.20E-06 mr1748 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823786747 NA 1.11E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823786747 NA 1.13E-06 mr1955 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251