\
| Variant ID: vg0823786747 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 23786747 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGCTAGATCCGAGAGTAAGGTCTCTTGGTTGCGCGTTTTCACAACCAAGTCATCAACATAGGCCTCAACATTACGTCCTATTTGGCTACCCAAAGAAATT[T/C]
GAGTAGTACGTTGAAAAGTAGGACCTGCATTGTTTAGCCCGAAAGGCATTGTCGTATAACAATAAGTTCCTATGGGGGTTATGAATGCAGTTTTTTCCTC
GAGGAAAAAACTGCATTCATAACCCCCATAGGAACTTATTGTTATACGACAATGCCTTTCGGGCTAAACAATGCAGGTCCTACTTTTCAACGTACTACTC[A/G]
AATTTCTTTGGGTAGCCAAATAGGACGTAATGTTGAGGCCTATGTTGATGACTTGGTTGTGAAAACGCGCAACCAAGAGACCTTACTCTCGGATCTAGCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.40% | 11.20% | 6.20% | 0.19% | NA |
| All Indica | 2759 | 92.50% | 1.70% | 5.47% | 0.29% | NA |
| All Japonica | 1512 | 60.80% | 31.20% | 8.00% | 0.00% | NA |
| Aus | 269 | 94.40% | 0.70% | 4.46% | 0.37% | NA |
| Indica I | 595 | 83.00% | 3.90% | 13.11% | 0.00% | NA |
| Indica II | 465 | 92.90% | 1.70% | 3.87% | 1.51% | NA |
| Indica III | 913 | 99.30% | 0.10% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 91.60% | 1.90% | 6.36% | 0.13% | NA |
| Temperate Japonica | 767 | 40.80% | 46.50% | 12.65% | 0.00% | NA |
| Tropical Japonica | 504 | 92.70% | 4.40% | 2.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.10% | 38.20% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 10.00% | 8.89% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0823786747 | T -> C | LOC_Os08g37560.1 | missense_variant ; p.Gln853Arg; MODERATE | nonsynonymous_codon ; Q853R | Average:32.928; most accessible tissue: Zhenshan97 flower, score: 49.187 | unknown | unknown | TOLERATED | 1.00 |
| vg0823786747 | T -> DEL | LOC_Os08g37560.1 | N | frameshift_variant | Average:32.928; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0823786747 | NA | 8.43E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823786747 | NA | 6.23E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823786747 | NA | 1.96E-07 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823786747 | NA | 1.51E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823786747 | 4.06E-06 | 4.05E-06 | mr1494 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823786747 | NA | 8.93E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823786747 | NA | 1.97E-09 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823786747 | NA | 1.20E-06 | mr1748 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823786747 | NA | 1.11E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823786747 | NA | 1.13E-06 | mr1955 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |