Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0823650185:

Variant ID: vg0823650185 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 23650185
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


AGAACACAGTACCGGTTCAGAATGCGTGAAACGCATTTATGGGCGTGTGAGCTCGGGGAGTTAATGTGCTGTTCGGCTTTTGCCGCTGTGTGTCTGCAGG[G/A]
GAGGGTGTTGCAATGCCAGGAAGCGATTCAGGATCATCACTACTCCATGGCCACCATTAACACTGTGCAACCTAAACCTGCAAGCACCAGGAGAGGCTCA

Reverse complement sequence

TGAGCCTCTCCTGGTGCTTGCAGGTTTAGGTTGCACAGTGTTAATGGTGGCCATGGAGTAGTGATGATCCTGAATCGCTTCCTGGCATTGCAACACCCTC[C/T]
CCTGCAGACACACAGCGGCAAAAGCCGAACAGCACATTAACTCCCCGAGCTCACACGCCCATAAATGCGTTTCACGCATTCTGAACCGGTACTGTGTTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.10% 29.60% 0.34% 0.02% NA
All Indica  2759 98.60% 1.10% 0.29% 0.04% NA
All Japonica  1512 15.20% 84.30% 0.46% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 99.30% 0.30% 0.34% 0.00% NA
Indica II  465 98.70% 0.90% 0.43% 0.00% NA
Indica III  913 99.00% 0.70% 0.22% 0.11% NA
Indica Intermediate  786 97.60% 2.20% 0.25% 0.00% NA
Temperate Japonica  767 4.80% 94.80% 0.39% 0.00% NA
Tropical Japonica  504 33.90% 65.70% 0.40% 0.00% NA
Japonica Intermediate  241 9.10% 90.00% 0.83% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 67.80% 31.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0823650185 G -> A LOC_Os08g37390.1 missense_variant&splice_region_variant ; p.Gly290Glu; MODERATE nonsynonymous_codon ; G290E Average:84.815; most accessible tissue: Zhenshan97 panicle, score: 97.534 unknown unknown TOLERATED 1.00
vg0823650185 G -> DEL LOC_Os08g37390.1 N frameshift_variant Average:84.815; most accessible tissue: Zhenshan97 panicle, score: 97.534 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0823650185 G A -0.01 -0.01 -0.01 -0.05 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0823650185 NA 4.34E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823650185 NA 2.99E-44 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823650185 NA 1.99E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823650185 NA 3.15E-25 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823650185 NA 1.11E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823650185 NA 7.22E-23 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823650185 NA 4.61E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823650185 NA 1.83E-07 mr1758_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823650185 6.41E-07 NA mr1849_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823650185 NA 5.01E-06 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251