\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0823591909:

Variant ID: vg0823591909 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 23591909
Reference Allele: CTTGAAlternative Allele: TTTGA,C
Primary Allele: CTTGASecondary Allele: TTTGA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATATTTATCATCTAATGATAAAAAAATATTGATCATAAAAAAATTTAAATAAAATGGGCGACTAAATATTAAACATAGAAACCGACAAATAAATTTAT[CTTGA/TTTGA,C]
GACAGACGGTGTACTTGGCCCGTGGAATAGGATGGAGTTAATGTTGTTCGCTTTTTAAGGGAAAGAATCCAAAGCTAGCCGCACTCTGCTATCAATCGGT

Reverse complement sequence

ACCGATTGATAGCAGAGTGCGGCTAGCTTTGGATTCTTTCCCTTAAAAAGCGAACAACATTAACTCCATCCTATTCCACGGGCCAAGTACACCGTCTGTC[TCAAG/TCAAA,G]
ATAAATTTATTTGTCGGTTTCTATGTTTAATATTTAGTCGCCCATTTTATTTAAATTTTTTTATGATCAATATTTTTTTATCATTAGATGATAAATATGA

Allele Frequencies:

Populations Population SizeFrequency of CTTGA(primary allele) Frequency of TTTGA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 4.40% 0.23% 0.00% C: 0.02%
All Indica  2759 99.10% 0.80% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 39.00% 57.20% 3.35% 0.00% C: 0.37%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.70% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 28.10% 1.04% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0823591909 CTTGA -> C LOC_Os08g37340.1 upstream_gene_variant ; 4539.0bp to feature; MODIFIER silent_mutation Average:96.093; most accessible tissue: Minghui63 young leaf, score: 98.18 N N N N
vg0823591909 CTTGA -> C LOC_Os08g37345.1 upstream_gene_variant ; 1333.0bp to feature; MODIFIER silent_mutation Average:96.093; most accessible tissue: Minghui63 young leaf, score: 98.18 N N N N
vg0823591909 CTTGA -> C LOC_Os08g37350.1 downstream_gene_variant ; 1782.0bp to feature; MODIFIER silent_mutation Average:96.093; most accessible tissue: Minghui63 young leaf, score: 98.18 N N N N
vg0823591909 CTTGA -> C LOC_Os08g37345-LOC_Os08g37350 intergenic_region ; MODIFIER silent_mutation Average:96.093; most accessible tissue: Minghui63 young leaf, score: 98.18 N N N N
vg0823591909 CTTGA -> TTTGA LOC_Os08g37340.1 upstream_gene_variant ; 4538.0bp to feature; MODIFIER silent_mutation Average:96.093; most accessible tissue: Minghui63 young leaf, score: 98.18 N N N N
vg0823591909 CTTGA -> TTTGA LOC_Os08g37345.1 upstream_gene_variant ; 1332.0bp to feature; MODIFIER silent_mutation Average:96.093; most accessible tissue: Minghui63 young leaf, score: 98.18 N N N N
vg0823591909 CTTGA -> TTTGA LOC_Os08g37350.1 downstream_gene_variant ; 1783.0bp to feature; MODIFIER silent_mutation Average:96.093; most accessible tissue: Minghui63 young leaf, score: 98.18 N N N N
vg0823591909 CTTGA -> TTTGA LOC_Os08g37345-LOC_Os08g37350 intergenic_region ; MODIFIER silent_mutation Average:96.093; most accessible tissue: Minghui63 young leaf, score: 98.18 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0823591909 CTTGA C -0.05 0.15 0.24 -0.05 0.03 0.02
vg0823591909 CTTGA TTTGA 0.0 0.07 0.07 0.02 0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0823591909 NA 1.53E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823591909 NA 1.06E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823591909 NA 1.00E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823591909 NA 3.59E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823591909 NA 2.09E-15 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823591909 NA 5.93E-08 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823591909 NA 5.82E-12 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823591909 NA 1.78E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823591909 NA 7.36E-07 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823591909 NA 1.18E-37 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823591909 NA 3.51E-07 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823591909 2.51E-07 8.90E-35 mr1549_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823591909 NA 2.43E-28 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251