\
| Variant ID: vg0823588721 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 23588721 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCTCCAAATTTTTTTCCTTAGTTAATGGCCTATATGCATGCATGCCTTATATTATGGAACATCTTAAAAAAGTGGTTGTGCCTTATATTATGGAATGGAG[G/A]
GAGTACTACTAGAACCAGAATAGGATAATAATTCTAAATTTATATCCATGTAATTTTGGCCCTTTTGTCAATCAGAATCATGGTCAGAACAAGCTTGTTT
AAACAAGCTTGTTCTGACCATGATTCTGATTGACAAAAGGGCCAAAATTACATGGATATAAATTTAGAATTATTATCCTATTCTGGTTCTAGTAGTACTC[C/T]
CTCCATTCCATAATATAAGGCACAACCACTTTTTTAAGATGTTCCATAATATAAGGCATGCATGCATATAGGCCATTAACTAAGGAAAAAAATTTGGAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.70% | 5.10% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 84.30% | 15.10% | 0.60% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.40% | 2.10% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 60.50% | 38.50% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0823588721 | G -> A | LOC_Os08g37340.1 | upstream_gene_variant ; 1350.0bp to feature; MODIFIER | silent_mutation | Average:79.526; most accessible tissue: Callus, score: 94.535 | N | N | N | N |
| vg0823588721 | G -> A | LOC_Os08g37345.1 | downstream_gene_variant ; 882.0bp to feature; MODIFIER | silent_mutation | Average:79.526; most accessible tissue: Callus, score: 94.535 | N | N | N | N |
| vg0823588721 | G -> A | LOC_Os08g37350.1 | downstream_gene_variant ; 4971.0bp to feature; MODIFIER | silent_mutation | Average:79.526; most accessible tissue: Callus, score: 94.535 | N | N | N | N |
| vg0823588721 | G -> A | LOC_Os08g37340-LOC_Os08g37345 | intergenic_region ; MODIFIER | silent_mutation | Average:79.526; most accessible tissue: Callus, score: 94.535 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0823588721 | NA | 1.94E-08 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823588721 | NA | 9.96E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823588721 | NA | 3.35E-15 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823588721 | NA | 1.90E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823588721 | NA | 5.41E-29 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823588721 | NA | 9.68E-12 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823588721 | NA | 1.51E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823588721 | NA | 2.22E-14 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823588721 | 4.04E-06 | NA | mr1448_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823588721 | NA | 9.86E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823588721 | NA | 2.26E-06 | mr1553_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823588721 | NA | 2.74E-13 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823588721 | NA | 3.54E-13 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |