| Variant ID: vg0823456465 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 23456465 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, T: 0.15, others allele: 0.00, population size: 103. )
AAAAAAAAGTTCAAGTCGAAATACAATTTAAAAAGAGCAGAAATTCAGAATTAAAAATAAGCAATATTGAATGAAGAGTCCATATAAGAACTCAATACGA[G/T,A]
ATTAATCAAAATTCGGAATAAAAACAAAATAAAATCCGAAATTAGAAAAGAAAATGAGAGTCCAAGTAGGAATACAATTTAAAAATAACTGAAATTCGAA
TTCGAATTTCAGTTATTTTTAAATTGTATTCCTACTTGGACTCTCATTTTCTTTTCTAATTTCGGATTTTATTTTGTTTTTATTCCGAATTTTGATTAAT[C/A,T]
TCGTATTGAGTTCTTATATGGACTCTTCATTCAATATTGCTTATTTTTAATTCTGAATTTCTGCTCTTTTTAAATTGTATTTCGACTTGAACTTTTTTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.70% | 34.10% | 0.15% | 0.00% | A: 0.04% |
| All Indica | 2759 | 98.20% | 1.70% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 1.50% | 98.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 86.60% | 13.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 3.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 37.80% | 2.22% | 0.00% | A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0823456465 | G -> T | LOC_Os08g37115.1 | downstream_gene_variant ; 3472.0bp to feature; MODIFIER | silent_mutation | Average:26.872; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0823456465 | G -> T | LOC_Os08g37120.1 | downstream_gene_variant ; 3880.0bp to feature; MODIFIER | silent_mutation | Average:26.872; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0823456465 | G -> T | LOC_Os08g37115-LOC_Os08g37120 | intergenic_region ; MODIFIER | silent_mutation | Average:26.872; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0823456465 | G -> A | LOC_Os08g37115.1 | downstream_gene_variant ; 3472.0bp to feature; MODIFIER | silent_mutation | Average:26.872; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0823456465 | G -> A | LOC_Os08g37120.1 | downstream_gene_variant ; 3880.0bp to feature; MODIFIER | silent_mutation | Average:26.872; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0823456465 | G -> A | LOC_Os08g37115-LOC_Os08g37120 | intergenic_region ; MODIFIER | silent_mutation | Average:26.872; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0823456465 | 3.92E-06 | NA | mr1240 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823456465 | NA | 1.51E-31 | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823456465 | NA | 4.30E-24 | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823456465 | NA | 6.92E-44 | mr1591 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823456465 | NA | 2.55E-35 | mr1828 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823456465 | NA | 9.69E-41 | mr1890 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823456465 | NA | 2.15E-19 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823456465 | NA | 4.47E-52 | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823456465 | NA | 2.52E-09 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823456465 | NA | 2.33E-11 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823456465 | NA | 4.10E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823456465 | NA | 3.09E-21 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |