Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0823360400:

Variant ID: vg0823360400 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 23360400
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CTCATTCAAATTTCTCTCATCTTACGCCAACTACTCTTTCACTTCCATCCTCTTAAGAGGTATATAGATCATTTTATCTTTCTCTTAATTTGCCTCTGAC[C/T]
TTTAGAATGACAGTTGTTTTGGGATGGAGGTCGTAGTATGTAACAACGGTATACTCCACGGTAGTGCATAACTGGAAGACAGGTTTTTATTTGGCAAAAT

Reverse complement sequence

ATTTTGCCAAATAAAAACCTGTCTTCCAGTTATGCACTACCGTGGAGTATACCGTTGTTACATACTACGACCTCCATCCCAAAACAACTGTCATTCTAAA[G/A]
GTCAGAGGCAAATTAAGAGAAAGATAAAATGATCTATATACCTCTTAAGAGGATGGAAGTGAAAGAGTAGTTGGCGTAAGATGAGAGAAATTTGAATGAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	32.50%	0.15%	0.36%	NA
All Indica	2759	98.70%	0.80%	0.11%	0.33%	NA
All Japonica	1512	2.20%	97.30%	0.20%	0.26%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.17%	0.17%	NA
Indica II	465	98.30%	1.10%	0.22%	0.43%	NA
Indica III	913	99.50%	0.40%	0.00%	0.11%	NA
Indica Intermediate	786	97.50%	1.80%	0.13%	0.64%	NA
Temperate Japonica	767	3.00%	96.50%	0.26%	0.26%	NA
Tropical Japonica	504	0.80%	99.00%	0.00%	0.20%	NA
Japonica Intermediate	241	2.90%	96.30%	0.41%	0.41%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	62.20%	32.20%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0823360400	C -> T	LOC_Os08g36930.1	upstream_gene_variant ; 2404.0bp to feature; MODIFIER	silent_mutation	Average:60.591; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0823360400	C -> T	LOC_Os08g36920-LOC_Os08g36930	intergenic_region ; MODIFIER	silent_mutation	Average:60.591; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0823360400	C -> DEL	N	N	silent_mutation	Average:60.591; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0823360400	NA	1.27E-08	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	1.03E-89	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	1.35E-78	mr1100	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	7.14E-44	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	3.42E-92	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	4.34E-12	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	8.43E-10	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	5.12E-98	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	5.29E-26	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	1.30E-31	mr1243	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	3.17E-27	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	7.19E-91	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	4.06E-31	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	1.12E-44	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	9.66E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	7.61E-43	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	1.16E-76	mr1613	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	3.76E-93	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	2.83E-66	mr1619	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	9.00E-75	mr1629	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	5.23E-13	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	8.43E-52	mr1692	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	1.82E-08	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	5.95E-36	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	1.60E-39	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	7.18E-39	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	1.40E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	1.21E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	2.01E-33	mr1932	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	3.51E-19	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	3.60E-99	mr1100_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	3.54E-13	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	1.92E-110	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	1.11E-19	mr1276_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	2.10E-33	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	4.21E-06	1.19E-58	mr1480_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	4.08E-25	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	4.62E-28	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	5.19E-18	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	2.23E-60	mr1695_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	1.72E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	3.43E-84	mr1711_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	5.00E-67	mr1828_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	4.00E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823360400	NA	2.43E-26	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251