\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0823243074:

Variant ID: vg0823243074 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 23243074
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATAAACATGCAACAATATTTTGGGACCCTAGCTAAACAGTTTTAATTCAAAAACTTTTCAACTACAAAGTTGTAGGTCGTGTCGAAGGCTACAATTTT[G/A]
ATATAAAGTTTGTCTTCATTAGAGTTCACATGAAAAAGTTATGAATTATTTTTTGATATAAAGTTTTTAGACCGTCCTGTTTAGGGACCGGGGTGACACA

Reverse complement sequence

TGTGTCACCCCGGTCCCTAAACAGGACGGTCTAAAAACTTTATATCAAAAAATAATTCATAACTTTTTCATGTGAACTCTAATGAAGACAAACTTTATAT[C/T]
AAAATTGTAGCCTTCGACACGACCTACAACTTTGTAGTTGAAAAGTTTTTGAATTAAAACTGTTTAGCTAGGGTCCCAAAATATTGTTGCATGTTTATAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.70% 33.90% 0.23% 0.19% NA
All Indica  2759 97.10% 2.50% 0.18% 0.25% NA
All Japonica  1512 1.70% 98.00% 0.26% 0.07% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 99.00% 0.30% 0.34% 0.34% NA
Indica II  465 98.50% 1.10% 0.22% 0.22% NA
Indica III  913 99.30% 0.40% 0.11% 0.11% NA
Indica Intermediate  786 92.20% 7.30% 0.13% 0.38% NA
Temperate Japonica  767 1.70% 98.00% 0.13% 0.13% NA
Tropical Japonica  504 1.20% 98.20% 0.60% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 57.80% 38.90% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0823243074 G -> A LOC_Os08g36790.1 downstream_gene_variant ; 2228.0bp to feature; MODIFIER silent_mutation Average:46.826; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0823243074 G -> A LOC_Os08g36790-LOC_Os08g36800 intergenic_region ; MODIFIER silent_mutation Average:46.826; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0823243074 G -> DEL N N silent_mutation Average:46.826; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0823243074 NA 3.49E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 7.81E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 9.46E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 2.99E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 7.29E-09 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 1.90E-31 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 5.40E-18 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 2.99E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 3.80E-10 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 1.65E-36 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 4.27E-07 mr1223_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 1.51E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 4.09E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 1.25E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 3.52E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 2.27E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 8.84E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 1.08E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 1.77E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 3.89E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 5.88E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 2.46E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 7.30E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 6.89E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 7.06E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 2.52E-12 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074 NA 8.43E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251