Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0823243074:

Variant ID: vg0823243074 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 23243074
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTATAAACATGCAACAATATTTTGGGACCCTAGCTAAACAGTTTTAATTCAAAAACTTTTCAACTACAAAGTTGTAGGTCGTGTCGAAGGCTACAATTTT[G/A]
ATATAAAGTTTGTCTTCATTAGAGTTCACATGAAAAAGTTATGAATTATTTTTTGATATAAAGTTTTTAGACCGTCCTGTTTAGGGACCGGGGTGACACA

Reverse complement sequence

TGTGTCACCCCGGTCCCTAAACAGGACGGTCTAAAAACTTTATATCAAAAAATAATTCATAACTTTTTCATGTGAACTCTAATGAAGACAAACTTTATAT[C/T]
AAAATTGTAGCCTTCGACACGACCTACAACTTTGTAGTTGAAAAGTTTTTGAATTAAAACTGTTTAGCTAGGGTCCCAAAATATTGTTGCATGTTTATAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.70%	33.90%	0.23%	0.19%	NA
All Indica	2759	97.10%	2.50%	0.18%	0.25%	NA
All Japonica	1512	1.70%	98.00%	0.26%	0.07%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	99.00%	0.30%	0.34%	0.34%	NA
Indica II	465	98.50%	1.10%	0.22%	0.22%	NA
Indica III	913	99.30%	0.40%	0.11%	0.11%	NA
Indica Intermediate	786	92.20%	7.30%	0.13%	0.38%	NA
Temperate Japonica	767	1.70%	98.00%	0.13%	0.13%	NA
Tropical Japonica	504	1.20%	98.20%	0.60%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	57.80%	38.90%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0823243074	G -> A	LOC_Os08g36790.1	downstream_gene_variant ; 2228.0bp to feature; MODIFIER	silent_mutation	Average:46.826; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0823243074	G -> A	LOC_Os08g36790-LOC_Os08g36800	intergenic_region ; MODIFIER	silent_mutation	Average:46.826; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0823243074	G -> DEL	N	N	silent_mutation	Average:46.826; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0823243074	NA	3.49E-16	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	7.81E-09	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	9.46E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	2.99E-22	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	7.29E-09	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	1.90E-31	mr1105_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	5.40E-18	mr1146_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	2.99E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	3.80E-10	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	1.65E-36	mr1223_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	4.27E-07	mr1223_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	1.51E-10	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	4.09E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	1.25E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	3.52E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	2.27E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	8.84E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	1.08E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	1.77E-17	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	3.89E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	5.88E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	2.46E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	7.30E-12	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	6.89E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	7.06E-14	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	2.52E-12	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823243074	NA	8.43E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251