\
| Variant ID: vg0823149834 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 23149834 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAGAATCCATATAAGAACCCAATACTAGATTAATTAAAACTCAAAAAAATAATATCCAAAATTAGAAAAATTAAAAGAGAGTTCAAGTAGTAATACAATT[T/C]
TGAAACAACTGAAATTCAAAAATAAAAAATAAAAATATTAAAAAAACACTATACAATTTATAAATAACTAAAATTGGTGATAAAAATAAAGATTATTGAA
TTCAATAATCTTTATTTTTATCACCAATTTTAGTTATTTATAAATTGTATAGTGTTTTTTTAATATTTTTATTTTTTATTTTTGAATTTCAGTTGTTTCA[A/G]
AATTGTATTACTACTTGAACTCTCTTTTAATTTTTCTAATTTTGGATATTATTTTTTTGAGTTTTAATTAATCTAGTATTGGGTTCTTATATGGATTCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.40% | 34.20% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 96.80% | 2.80% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 1.40% | 98.40% | 0.20% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.20% | 0.67% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.30% | 0.86% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.50% | 8.00% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 1.60% | 98.20% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 40.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0823149834 | T -> C | LOC_Os08g36670.1 | upstream_gene_variant ; 4997.0bp to feature; MODIFIER | silent_mutation | Average:18.412; most accessible tissue: Zhenshan97 young leaf, score: 24.604 | N | N | N | N |
| vg0823149834 | T -> C | LOC_Os08g36680.1 | intron_variant ; MODIFIER | silent_mutation | Average:18.412; most accessible tissue: Zhenshan97 young leaf, score: 24.604 | N | N | N | N |
| vg0823149834 | T -> C | LOC_Os08g36680.2 | intron_variant ; MODIFIER | silent_mutation | Average:18.412; most accessible tissue: Zhenshan97 young leaf, score: 24.604 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0823149834 | 6.78E-06 | NA | mr1004 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823149834 | NA | 1.24E-10 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823149834 | 7.99E-07 | NA | mr1011 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823149834 | 4.93E-07 | NA | mr1011 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823149834 | 9.05E-06 | NA | mr1012 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823149834 | NA | 2.14E-32 | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823149834 | NA | 1.49E-08 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823149834 | NA | 2.98E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823149834 | NA | 4.59E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823149834 | NA | 1.42E-33 | mr1932 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823149834 | NA | 2.21E-16 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823149834 | NA | 5.74E-19 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823149834 | NA | 1.14E-17 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823149834 | NA | 5.96E-10 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823149834 | NA | 6.68E-22 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |