Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0823144488:

Variant ID: vg0823144488 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 23144488
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.14, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTCTCTGCAAGGAAACTGCCCAATGCTTCACCGCCTCCTTCATCTCATCCTTATGAGCATACCTAGCACCCTCAATTACCTCGTTCTCCTTATACTCC[T/C]
AGGGTACATGATCACCCTCTGATATAACAAGTCCAGAGACGTCCTCATTTGCCCAATCAGTGGCCATTACATCACCTTCCTCATCGGATGATGCGTCGTC

Reverse complement sequence

GACGACGCATCATCCGATGAGGAAGGTGATGTAATGGCCACTGATTGGGCAAATGAGGACGTCTCTGGACTTGTTATATCAGAGGGTGATCATGTACCCT[A/G]
GGAGTATAAGGAGAACGAGGTAATTGAGGGTGCTAGGTATGCTCATAAGGATGAGATGAAGGAGGCGGTGAAGCATTGGGCAGTTTCCTTGCAGAGAGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 23.00% 3.55% 0.00% NA
All Indica  2759 96.60% 2.90% 0.47% 0.00% NA
All Japonica  1512 32.30% 58.00% 9.66% 0.00% NA
Aus  269 62.10% 37.50% 0.37% 0.00% NA
Indica I  595 98.30% 0.50% 1.18% 0.00% NA
Indica II  465 96.60% 3.20% 0.22% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 92.10% 7.30% 0.64% 0.00% NA
Temperate Japonica  767 54.20% 32.90% 12.91% 0.00% NA
Tropical Japonica  504 4.20% 89.90% 5.95% 0.00% NA
Japonica Intermediate  241 21.60% 71.40% 7.05% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 71.10% 20.00% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0823144488 T -> C LOC_Os08g36670.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:20.496; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg0823144488 T -> C LOC_Os08g36680.1 downstream_gene_variant ; 2729.0bp to feature; MODIFIER silent_mutation Average:20.496; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N
vg0823144488 T -> C LOC_Os08g36680.2 downstream_gene_variant ; 2729.0bp to feature; MODIFIER silent_mutation Average:20.496; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0823144488 NA 6.52E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 1.84E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 6.83E-25 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 7.45E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 6.14E-07 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 8.58E-11 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 2.92E-24 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 1.32E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 3.73E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 3.19E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 2.04E-07 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 3.09E-11 mr1302_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 2.46E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 3.35E-09 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 1.22E-07 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 4.66E-08 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 8.51E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 1.29E-09 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 4.02E-12 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 1.80E-15 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 9.10E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 2.10E-11 mr1604_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 6.09E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 6.19E-25 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 1.80E-08 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 2.41E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 1.59E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 1.19E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 6.24E-10 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 2.84E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 4.05E-10 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 1.14E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 3.26E-11 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823144488 NA 1.35E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251