\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0823140129:

Variant ID: vg0823140129 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 23140129
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGATGCGCATGACCGCACGCATATTCTCCTGCATCCAGTCGAAGGTCACCCTCTGCTCAACGTTAGTCAAGTGCAAACCTCTGTTCAACCTCACTTGGA[T/C]
TGCGGTGATATCGGCACTGATATCCCGTGCGGCATTGGCCTATGCAAGATGGAAATAAAAAATTCAGTAATTGTCCTATATTATGCAAGATAAACGAAAT

Reverse complement sequence

ATTTCGTTTATCTTGCATAATATAGGACAATTACTGAATTTTTTATTTCCATCTTGCATAGGCCAATGCCGCACGGGATATCAGTGCCGATATCACCGCA[A/G]
TCCAAGTGAGGTTGAACAGAGGTTTGCACTTGACTAACGTTGAGCAGAGGGTGACCTTCGACTGGATGCAGGAGAATATGCGTGCGGTCATGCGCATCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.90% 36.00% 18.54% 6.62% NA
All Indica  2759 53.20% 5.10% 30.45% 11.20% NA
All Japonica  1512 1.10% 98.70% 0.20% 0.07% NA
Aus  269 89.20% 6.70% 4.09% 0.00% NA
Indica I  595 49.90% 5.50% 32.27% 12.27% NA
Indica II  465 72.70% 4.50% 16.99% 5.81% NA
Indica III  913 46.90% 1.30% 37.24% 14.57% NA
Indica Intermediate  786 51.70% 9.50% 29.13% 9.67% NA
Temperate Japonica  767 1.00% 98.40% 0.39% 0.13% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 8.30% 4.17% 0.00% NA
Intermediate  90 32.20% 44.40% 20.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0823140129 T -> C LOC_Os08g36670.1 missense_variant ; p.Ile870Val; MODERATE nonsynonymous_codon ; I870V Average:50.691; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 unknown unknown TOLERATED 1.00
vg0823140129 T -> DEL LOC_Os08g36670.1 N frameshift_variant Average:50.691; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0823140129 NA 2.77E-42 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 2.58E-36 mr1243 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 5.56E-89 mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 1.86E-35 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 6.69E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 8.66E-40 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 1.28E-08 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 3.00E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 9.82E-35 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 1.21E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 2.95E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 1.56E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 5.23E-17 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 8.15E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 8.87E-35 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 6.47E-52 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 5.61E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823140129 NA 9.77E-22 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251