Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0823137827:

Variant ID: vg0823137827 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 23137827
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

TGAAAAAATAGTAATGTTATTCAGTTTGGGTAGAAATTTTGTGCAAATCATAGCGGATTTTGGAAACGGTTAGACATACAATGAAATCGTTGTCTACATT[G/A]
GGGCAGATAAAATATCTCCTTCCAAATGTTTGTTCTACAAAGGAGGTAGCCACCTGGCAGCGATCTTTGCACCCACACTTTGGACGCTCGGACCATTTAG

Reverse complement sequence

CTAAATGGTCCGAGCGTCCAAAGTGTGGGTGCAAAGATCGCTGCCAGGTGGCTACCTCCTTTGTAGAACAAACATTTGGAAGGAGATATTTTATCTGCCC[C/T]
AATGTAGACAACGATTTCATTGTATGTCTAACCGTTTCCAAAATCCGCTATGATTTGCACAAAATTTCTACCCAAACTGAATAACATTACTATTTTTTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.80%	3.00%	1.04%	0.19%	NA
All Indica	2759	99.90%	0.00%	0.00%	0.07%	NA
All Japonica	1512	88.10%	9.30%	2.65%	0.00%	NA
Aus	269	94.40%	0.00%	2.97%	2.60%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.00%	0.00%	0.43%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	81.00%	14.90%	4.17%	0.00%	NA
Tropical Japonica	504	99.40%	0.00%	0.60%	0.00%	NA
Japonica Intermediate	241	87.10%	10.80%	2.07%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0823137827	G -> A	LOC_Os08g36660.1	upstream_gene_variant ; 1944.0bp to feature; MODIFIER	silent_mutation	Average:39.107; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0823137827	G -> A	LOC_Os08g36670.1	intron_variant ; MODIFIER	silent_mutation	Average:39.107; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0823137827	G -> DEL	N	N	silent_mutation	Average:39.107; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0823137827	3.02E-06	3.02E-06	mr1342_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823137827	4.10E-06	NA	mr1923_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823137827	NA	2.66E-07	mr1923_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251