RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0823030389:

Variant ID: vg0823030389 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 23030389
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAGAAAAGACTGAGAGGAGAGGATAAGATTGGGTTAGGTGTGAAATTTTTTGAACTGCGGAAGAGGGACCATTTTTACATGCGGGCTACGGAAGAGGGA[G/A]
GGAAGTTACATAACTTTGTTATTAATGACTTTTTCAGATGAAATCATTTACTGCTTCAAAATATTATTTGAAGTTTTGAAATTCAAATTTTTATTTGATA

Reverse complement sequence

TATCAAATAAAAATTTGAATTTCAAAACTTCAAATAATATTTTGAAGCAGTAAATGATTTCATCTGAAAAAGTCATTAATAACAAAGTTATGTAACTTCC[C/T]
TCCCTCTTCCGTAGCCCGCATGTAAAAATGGTCCCTCTTCCGCAGTTCAAAAAATTTCACACCTAACCCAATCTTATCCTCTCCTCTCAGTCTTTTCTCT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.20%	21.80%	4.27%	0.74%	NA
All Indica	2759	95.50%	0.50%	2.72%	1.27%	NA
All Japonica	1512	26.70%	65.70%	7.54%	0.00%	NA
Aus	269	97.40%	1.10%	1.49%	0.00%	NA
Indica I	595	94.30%	0.20%	4.37%	1.18%	NA
Indica II	465	92.30%	0.90%	4.30%	2.58%	NA
Indica III	913	99.70%	0.00%	0.11%	0.22%	NA
Indica Intermediate	786	93.40%	1.30%	3.56%	1.78%	NA
Temperate Japonica	767	5.30%	92.70%	1.96%	0.00%	NA
Tropical Japonica	504	62.90%	19.00%	18.06%	0.00%	NA
Japonica Intermediate	241	19.10%	77.60%	3.32%	0.00%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	75.60%	15.60%	8.89%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0823030389	G -> A	LOC_Os08g36480.1	upstream_gene_variant ; 2841.0bp to feature; MODIFIER	silent_mutation	Average:45.277; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0823030389	G -> A	LOC_Os08g36470-LOC_Os08g36480	intergenic_region ; MODIFIER	silent_mutation	Average:45.277; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0823030389	G -> DEL	N	N	silent_mutation	Average:45.277; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0823030389	NA	5.06E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823030389	NA	3.77E-08	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823030389	NA	1.60E-21	mr1276_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823030389	NA	2.66E-21	mr1682_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823030389	NA	4.06E-06	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0823030389:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact