Variant ID: vg0823019901 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 23019901 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 268. )
AAAAATAGATCAGATGTACTCCCTCCGTCCCATAAAAATGAATCTAGGACTGGATGTGATGCATTCTAGTAAGGTATGTTCAGATTCGTTGTAATAGAAT[G/A]
TGTCACATCCGATACTAGGTTGATTTTTATGGGATAGAGGGAGTAATGACTTATGATATATTGATTTGTTAGTTGTTTTTTTAAAAAATTTAACAGCAAA
TTTGCTGTTAAATTTTTTAAAAAAACAACTAACAAATCAATATATCATAAGTCATTACTCCCTCTATCCCATAAAAATCAACCTAGTATCGGATGTGACA[C/T]
ATTCTATTACAACGAATCTGAACATACCTTACTAGAATGCATCACATCCAGTCCTAGATTCATTTTTATGGGACGGAGGGAGTACATCTGATCTATTTTT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 99.50% | 0.40% | 0.15% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 98.30% | 1.20% | 0.46% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 97.00% | 2.30% | 0.65% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0823019901 | G -> A | LOC_Os08g36470.1 | upstream_gene_variant ; 3294.0bp to feature; MODIFIER | silent_mutation | Average:36.999; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
vg0823019901 | G -> A | LOC_Os08g36460-LOC_Os08g36470 | intergenic_region ; MODIFIER | silent_mutation | Average:36.999; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0823019901 | 3.59E-06 | 2.33E-13 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0823019901 | 2.14E-06 | 9.23E-09 | mr1071 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823019901 | NA | 7.35E-08 | mr1080 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823019901 | NA | 5.66E-07 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823019901 | 2.41E-06 | 2.19E-08 | mr1140 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823019901 | NA | 1.18E-07 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823019901 | 1.16E-06 | 2.47E-08 | mr1395 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823019901 | NA | 5.71E-07 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823019901 | 2.35E-06 | 2.94E-08 | mr1618 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823019901 | NA | 1.26E-06 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/