\
| Variant ID: vg0823004291 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 23004291 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGCAGTTTAAATAATGAAATCGGGTTGCATTTCATCTTGAAATTATCGAATGCTGATTGATGTTATCATGTTAGCTTGTTCAACAGGATTTGTTTTTTGT[G/A]
GTTACTATCATAAATCCAGAGTTTTGTGCAATCAGAAAGGATGTCCTTTTAACCTGTTGCTTGAGATGGTTGAAATTTGAAAGCTGTTTTCCTGAAGATG
CATCTTCAGGAAAACAGCTTTCAAATTTCAACCATCTCAAGCAACAGGTTAAAAGGACATCCTTTCTGATTGCACAAAACTCTGGATTTATGATAGTAAC[C/T]
ACAAAAAACAAATCCTGTTGAACAAGCTAACATGATAACATCAATCAGCATTCGATAATTTCAAGATGAAATGCAACCCGATTTCATTATTTAAACTGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.90% | 7.70% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 76.10% | 22.80% | 1.12% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.50% | 2.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 38.50% | 58.90% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.30% | 12.40% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0823004291 | G -> A | LOC_Os08g36450.1 | downstream_gene_variant ; 1153.0bp to feature; MODIFIER | silent_mutation | Average:78.602; most accessible tissue: Callus, score: 90.14 | N | N | N | N |
| vg0823004291 | G -> A | LOC_Os08g36460.1 | downstream_gene_variant ; 750.0bp to feature; MODIFIER | silent_mutation | Average:78.602; most accessible tissue: Callus, score: 90.14 | N | N | N | N |
| vg0823004291 | G -> A | LOC_Os08g36450-LOC_Os08g36460 | intergenic_region ; MODIFIER | silent_mutation | Average:78.602; most accessible tissue: Callus, score: 90.14 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0823004291 | NA | 1.88E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 1.87E-08 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 5.51E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 2.01E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 3.78E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 1.55E-07 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 1.23E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 1.47E-38 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 9.48E-20 | mr1699 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | 2.98E-07 | 6.86E-13 | mr1769 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 1.01E-17 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 1.84E-12 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 1.34E-07 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 4.47E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 5.99E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 1.87E-33 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 8.23E-17 | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 4.03E-13 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 1.23E-13 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | 3.42E-06 | NA | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0823004291 | NA | 1.28E-19 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |