Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0823004291:

Variant ID: vg0823004291 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 23004291
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGCAGTTTAAATAATGAAATCGGGTTGCATTTCATCTTGAAATTATCGAATGCTGATTGATGTTATCATGTTAGCTTGTTCAACAGGATTTGTTTTTTGT[G/A]
GTTACTATCATAAATCCAGAGTTTTGTGCAATCAGAAAGGATGTCCTTTTAACCTGTTGCTTGAGATGGTTGAAATTTGAAAGCTGTTTTCCTGAAGATG

Reverse complement sequence

CATCTTCAGGAAAACAGCTTTCAAATTTCAACCATCTCAAGCAACAGGTTAAAAGGACATCCTTTCTGATTGCACAAAACTCTGGATTTATGATAGTAAC[C/T]
ACAAAAAACAAATCCTGTTGAACAAGCTAACATGATAACATCAATCAGCATTCGATAATTTCAAGATGAAATGCAACCCGATTTCATTATTTAAACTGCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.90%	7.70%	0.40%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.04%	0.00%	NA
All Japonica	1512	76.10%	22.80%	1.12%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.50%	0.13%	0.00%	NA
Temperate Japonica	767	97.50%	2.30%	0.13%	0.00%	NA
Tropical Japonica	504	38.50%	58.90%	2.58%	0.00%	NA
Japonica Intermediate	241	86.30%	12.40%	1.24%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0823004291	G -> A	LOC_Os08g36450.1	downstream_gene_variant ; 1153.0bp to feature; MODIFIER	silent_mutation	Average:78.602; most accessible tissue: Callus, score: 90.14	N	N	N	N
vg0823004291	G -> A	LOC_Os08g36460.1	downstream_gene_variant ; 750.0bp to feature; MODIFIER	silent_mutation	Average:78.602; most accessible tissue: Callus, score: 90.14	N	N	N	N
vg0823004291	G -> A	LOC_Os08g36450-LOC_Os08g36460	intergenic_region ; MODIFIER	silent_mutation	Average:78.602; most accessible tissue: Callus, score: 90.14	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0823004291	NA	1.88E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	1.87E-08	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	5.51E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	2.01E-06	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	3.78E-09	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	1.55E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	1.23E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	1.47E-38	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	9.48E-20	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	2.98E-07	6.86E-13	mr1769	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	1.01E-17	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	1.84E-12	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	1.34E-07	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	4.47E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	5.99E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	1.87E-33	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	8.23E-17	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	4.03E-13	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	1.23E-13	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	3.42E-06	NA	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0823004291	NA	1.28E-19	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251