Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822995683:

Variant ID: vg0822995683 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 22995683
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGTTCTCCGAGCAACATTCGATCCTTTCGTGTCATTCTGACTAAGATTTAGTTCCAAACTTTTTCATCACATCAAAATTTTTCTATACACATAAACTTT[T/C]
AACTTTTTTATTACATCATTCCAATTTCAATCAAACTTTTAATTTTGACGTGATCTAAACACACGGCCTTAGCGAAAGGTGCAGCCGGCCGGGCTCTCTC

Reverse complement sequence

GAGAGAGCCCGGCCGGCTGCACCTTTCGCTAAGGCCGTGTGTTTAGATCACGTCAAAATTAAAAGTTTGATTGAAATTGGAATGATGTAATAAAAAAGTT[A/G]
AAAGTTTATGTGTATAGAAAAATTTTGATGTGATGAAAAAGTTTGGAACTAAATCTTAGTCAGAATGACACGAAAGGATCGAATGTTGCTCGGAGAACTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.50%	35.30%	13.10%	3.20%	NA
All Indica	2759	71.70%	1.70%	21.53%	5.11%	NA
All Japonica	1512	1.00%	98.10%	0.73%	0.20%	NA
Aus	269	63.20%	35.70%	1.12%	0.00%	NA
Indica I	595	66.20%	0.20%	30.92%	2.69%	NA
Indica II	465	72.90%	3.00%	18.92%	5.16%	NA
Indica III	913	74.90%	0.40%	17.63%	7.01%	NA
Indica Intermediate	786	71.40%	3.40%	20.48%	4.71%	NA
Temperate Japonica	767	0.80%	98.00%	0.78%	0.39%	NA
Tropical Japonica	504	0.80%	98.80%	0.40%	0.00%	NA
Japonica Intermediate	241	2.10%	96.70%	1.24%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	44.40%	35.60%	12.22%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0822995683	T -> C	LOC_Os08g36420.1	upstream_gene_variant ; 521.0bp to feature; MODIFIER	silent_mutation	Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004	N	N	N	N
vg0822995683	T -> C	LOC_Os08g36440.1	upstream_gene_variant ; 861.0bp to feature; MODIFIER	silent_mutation	Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004	N	N	N	N
vg0822995683	T -> C	LOC_Os08g36420.2	upstream_gene_variant ; 521.0bp to feature; MODIFIER	silent_mutation	Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004	N	N	N	N
vg0822995683	T -> C	LOC_Os08g36420.3	upstream_gene_variant ; 521.0bp to feature; MODIFIER	silent_mutation	Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004	N	N	N	N
vg0822995683	T -> C	LOC_Os08g36420.5	upstream_gene_variant ; 521.0bp to feature; MODIFIER	silent_mutation	Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004	N	N	N	N
vg0822995683	T -> C	LOC_Os08g36420.4	upstream_gene_variant ; 210.0bp to feature; MODIFIER	silent_mutation	Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004	N	N	N	N
vg0822995683	T -> C	LOC_Os08g36440.2	upstream_gene_variant ; 1052.0bp to feature; MODIFIER	silent_mutation	Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004	N	N	N	N
vg0822995683	T -> C	LOC_Os08g36420-LOC_Os08g36440	intergenic_region ; MODIFIER	silent_mutation	Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004	N	N	N	N
vg0822995683	T -> DEL	N	N	silent_mutation	Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0822995683	T	C	-0.01	0.0	0.0	-0.03	-0.02	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0822995683	NA	1.24E-09	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	2.34E-49	mr1519	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	1.96E-25	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	8.62E-11	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	5.09E-06	4.68E-50	mr1591	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	1.94E-57	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	1.34E-49	mr1599	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	3.40E-19	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	1.47E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	2.41E-28	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	1.66E-38	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	2.71E-12	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	3.89E-35	mr1223_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	2.03E-22	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	9.64E-16	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	1.20E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	1.72E-20	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	3.07E-13	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683	NA	1.80E-40	mr1944_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251