\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822995683:

Variant ID: vg0822995683 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 22995683
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTTCTCCGAGCAACATTCGATCCTTTCGTGTCATTCTGACTAAGATTTAGTTCCAAACTTTTTCATCACATCAAAATTTTTCTATACACATAAACTTT[T/C]
AACTTTTTTATTACATCATTCCAATTTCAATCAAACTTTTAATTTTGACGTGATCTAAACACACGGCCTTAGCGAAAGGTGCAGCCGGCCGGGCTCTCTC

Reverse complement sequence

GAGAGAGCCCGGCCGGCTGCACCTTTCGCTAAGGCCGTGTGTTTAGATCACGTCAAAATTAAAAGTTTGATTGAAATTGGAATGATGTAATAAAAAAGTT[A/G]
AAAGTTTATGTGTATAGAAAAATTTTGATGTGATGAAAAAGTTTGGAACTAAATCTTAGTCAGAATGACACGAAAGGATCGAATGTTGCTCGGAGAACTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.50% 35.30% 13.10% 3.20% NA
All Indica  2759 71.70% 1.70% 21.53% 5.11% NA
All Japonica  1512 1.00% 98.10% 0.73% 0.20% NA
Aus  269 63.20% 35.70% 1.12% 0.00% NA
Indica I  595 66.20% 0.20% 30.92% 2.69% NA
Indica II  465 72.90% 3.00% 18.92% 5.16% NA
Indica III  913 74.90% 0.40% 17.63% 7.01% NA
Indica Intermediate  786 71.40% 3.40% 20.48% 4.71% NA
Temperate Japonica  767 0.80% 98.00% 0.78% 0.39% NA
Tropical Japonica  504 0.80% 98.80% 0.40% 0.00% NA
Japonica Intermediate  241 2.10% 96.70% 1.24% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 44.40% 35.60% 12.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0822995683 T -> C LOC_Os08g36420.1 upstream_gene_variant ; 521.0bp to feature; MODIFIER silent_mutation Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004 N N N N
vg0822995683 T -> C LOC_Os08g36440.1 upstream_gene_variant ; 861.0bp to feature; MODIFIER silent_mutation Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004 N N N N
vg0822995683 T -> C LOC_Os08g36420.2 upstream_gene_variant ; 521.0bp to feature; MODIFIER silent_mutation Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004 N N N N
vg0822995683 T -> C LOC_Os08g36420.3 upstream_gene_variant ; 521.0bp to feature; MODIFIER silent_mutation Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004 N N N N
vg0822995683 T -> C LOC_Os08g36420.5 upstream_gene_variant ; 521.0bp to feature; MODIFIER silent_mutation Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004 N N N N
vg0822995683 T -> C LOC_Os08g36420.4 upstream_gene_variant ; 210.0bp to feature; MODIFIER silent_mutation Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004 N N N N
vg0822995683 T -> C LOC_Os08g36440.2 upstream_gene_variant ; 1052.0bp to feature; MODIFIER silent_mutation Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004 N N N N
vg0822995683 T -> C LOC_Os08g36420-LOC_Os08g36440 intergenic_region ; MODIFIER silent_mutation Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004 N N N N
vg0822995683 T -> DEL N N silent_mutation Average:85.93; most accessible tissue: Minghui63 panicle, score: 98.004 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0822995683 T C -0.01 0.0 0.0 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0822995683 NA 1.24E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 2.34E-49 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 1.96E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 8.62E-11 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 5.09E-06 4.68E-50 mr1591 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 1.94E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 1.34E-49 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 3.40E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 1.47E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 2.41E-28 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 1.66E-38 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 2.71E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 3.89E-35 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 2.03E-22 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 9.64E-16 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 1.20E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 1.72E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 3.07E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822995683 NA 1.80E-40 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251