\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822806279:

Variant ID: vg0822806279 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 22806279
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAATAAGTCCTCTATTTAATTTAAGGATTGCAATGATTCATATTTGTCACCGTGGGTACCAGCGCTATGTCCTGGGACTGGTACTGTGATCGTGGTTTC[A/G]
TAGGAAGCGGTTCGCGCCGTTTTTCCTACGATACACTCCTATCAGGTGCCGTTGTACGGCGGTGCCAGATTGGGGTGTGACAAACGGCAACGGTGGCGAT

Reverse complement sequence

ATCGCCACCGTTGCCGTTTGTCACACCCCAATCTGGCACCGCCGTACAACGGCACCTGATAGGAGTGTATCGTAGGAAAAACGGCGCGAACCGCTTCCTA[T/C]
GAAACCACGATCACAGTACCAGTCCCAGGACATAGCGCTGGTACCCACGGTGACAAATATGAATCATTGCAATCCTTAAATTAAATAGAGGACTTATTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 33.00% 0.11% 0.00% NA
All Indica  2759 98.60% 1.30% 0.14% 0.00% NA
All Japonica  1512 1.70% 98.30% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 2.50% 0.13% 0.00% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0822806279 A -> G LOC_Os08g36170.1 upstream_gene_variant ; 2186.0bp to feature; MODIFIER silent_mutation Average:71.528; most accessible tissue: Zhenshan97 flag leaf, score: 83.04 N N N N
vg0822806279 A -> G LOC_Os08g36160-LOC_Os08g36170 intergenic_region ; MODIFIER silent_mutation Average:71.528; most accessible tissue: Zhenshan97 flag leaf, score: 83.04 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0822806279 NA 8.09E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 5.99E-11 mr1005 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 3.24E-45 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 2.03E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 1.82E-42 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 4.55E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 1.24E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 7.85E-21 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 2.90E-34 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 5.50E-74 mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 7.78E-17 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 1.17E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 1.29E-55 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 5.64E-55 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 1.99E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 1.41E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 6.72E-84 mr1711_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 8.26E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 1.10E-14 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 3.80E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 1.76E-81 mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 7.15E-23 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822806279 NA 1.41E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251