\
| Variant ID: vg0822783342 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 22783342 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.19, others allele: 0.00, population size: 177. )
AACCGGTCTTTCCGCCACCTCGGTACGTGTTCGACATGTTGCGTATATTTGATCTGTTCATGTTTTACTGCTTAGTTTACATGTGTAGATCTAATGATGT[G/A]
TTAATGCTAGTATACATCTGTAATGTCATGATTTATTTATGAAATATATTAAATCATTATATGCCTATATTCTCAACAATCCAAAAACTTTATTATAGGC
GCCTATAATAAAGTTTTTGGATTGTTGAGAATATAGGCATATAATGATTTAATATATTTCATAAATAAATCATGACATTACAGATGTATACTAGCATTAA[C/T]
ACATCATTAGATCTACACATGTAAACTAAGCAGTAAAACATGAACAGATCAAATATACGCAACATGTCGAACACGTACCGAGGTGGCGGAAAGACCGGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 33.50% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 1.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 2.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 4.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 43.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0822783342 | G -> A | LOC_Os08g36150.1 | upstream_gene_variant ; 2076.0bp to feature; MODIFIER | silent_mutation | Average:37.57; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| vg0822783342 | G -> A | LOC_Os08g36160.1 | upstream_gene_variant ; 115.0bp to feature; MODIFIER | silent_mutation | Average:37.57; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| vg0822783342 | G -> A | LOC_Os08g36150.2 | upstream_gene_variant ; 2182.0bp to feature; MODIFIER | silent_mutation | Average:37.57; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| vg0822783342 | G -> A | LOC_Os08g36150-LOC_Os08g36160 | intergenic_region ; MODIFIER | silent_mutation | Average:37.57; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0822783342 | NA | 3.95E-36 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822783342 | NA | 5.03E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822783342 | NA | 8.96E-21 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822783342 | NA | 1.59E-08 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822783342 | NA | 9.92E-13 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822783342 | NA | 4.44E-14 | mr1326_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822783342 | NA | 3.23E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822783342 | NA | 7.06E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822783342 | NA | 2.19E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822783342 | NA | 1.06E-10 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822783342 | NA | 3.45E-12 | mr1553_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822783342 | NA | 1.05E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822783342 | NA | 1.61E-58 | mr1695_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822783342 | NA | 5.42E-14 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822783342 | NA | 3.18E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |