Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822641799:

Variant ID: vg0822641799 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 22641799
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CTGATAAGCATAAGCATAAGCGAAAAGATGAGGTTGTTCATATTTTGGCTTTAACCATCTTGCATGGATTTGTTAAACCCAAAGACCGAACCAAGTAGCC[T/A]
GCAGTTCAGTCCAAAACAAGCCAAGCAATATATTGCTTCTTCTGTAACTAACAGATACTTGTAATTTAATGTATGTGTAAGACTATATAACAAGAAAATA

Reverse complement sequence

TATTTTCTTGTTATATAGTCTTACACATACATTAAATTACAAGTATCTGTTAGTTACAGAAGAAGCAATATATTGCTTGGCTTGTTTTGGACTGAACTGC[A/T]
GGCTACTTGGTTCGGTCTTTGGGTTTAACAAATCCATGCAAGATGGTTAAAGCCAAAATATGAACAACCTCATCTTTTCGCTTATGCTTATGCTTATCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.20% 12.30% 1.42% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 58.30% 37.30% 4.37% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 33.80% 59.60% 6.65% 0.00% NA
Tropical Japonica  504 89.10% 9.50% 1.39% 0.00% NA
Japonica Intermediate  241 72.20% 24.50% 3.32% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0822641799 T -> A LOC_Os08g35880.1 upstream_gene_variant ; 3399.0bp to feature; MODIFIER silent_mutation Average:40.439; most accessible tissue: Callus, score: 73.587 N N N N
vg0822641799 T -> A LOC_Os08g35900.1 intron_variant ; MODIFIER silent_mutation Average:40.439; most accessible tissue: Callus, score: 73.587 N N N N
vg0822641799 T -> A LOC_Os08g35900.2 intron_variant ; MODIFIER silent_mutation Average:40.439; most accessible tissue: Callus, score: 73.587 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0822641799 NA 4.01E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0822641799 NA 2.50E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0822641799 NA 4.53E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0822641799 NA 1.19E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 4.96E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 6.66E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 9.18E-07 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 1.00E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 3.20E-06 6.71E-30 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 2.01E-11 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 1.04E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 1.92E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 7.65E-08 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 1.94E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 1.13E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 3.19E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 9.74E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 6.82E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 1.80E-06 8.94E-27 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 3.41E-10 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 3.08E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 3.07E-06 2.31E-06 mr1707 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 5.50E-11 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 4.83E-09 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 1.67E-06 mr1748 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 1.89E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 5.32E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 8.10E-09 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 2.85E-08 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 3.32E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 2.15E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 1.54E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 5.23E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 4.85E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 2.72E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 1.11E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 3.43E-08 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822641799 NA 2.69E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251