\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822600721:

Variant ID: vg0822600721 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 22600721
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, G: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGTCCAATCACTGGTGGAGAAACCATCTTTGATCGGTCAGGCAAAATCCACAATAGTCCCGGATCGAAAAAGAATCGGGACTAAAGATTGTTTTTAGT[C/G]
CTGGTTATAAAAATTTTGATCTTTAGTCCCGGTTGGTGTTAATAACCGGGACTAAAAATGACAACTTTAGTCCCGGTTGGTATTACCAAACGGGACTAAA

Reverse complement sequence

TTTAGTCCCGTTTGGTAATACCAACCGGGACTAAAGTTGTCATTTTTAGTCCCGGTTATTAACACCAACCGGGACTAAAGATCAAAATTTTTATAACCAG[G/C]
ACTAAAAACAATCTTTAGTCCCGATTCTTTTTCGATCCGGGACTATTGTGGATTTTGCCTGACCGATCAAAGATGGTTTCTCCACCAGTGATTGGACCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.80% 19.10% 30.43% 15.66% NA
All Indica  2759 1.70% 27.70% 46.54% 24.07% NA
All Japonica  1512 98.50% 0.70% 0.66% 0.20% NA
Aus  269 19.00% 31.20% 30.86% 18.96% NA
Indica I  595 0.30% 16.50% 58.66% 24.54% NA
Indica II  465 1.30% 28.80% 38.92% 30.97% NA
Indica III  913 1.00% 33.10% 46.00% 19.93% NA
Indica Intermediate  786 3.90% 29.10% 42.49% 24.43% NA
Temperate Japonica  767 98.30% 0.70% 0.78% 0.26% NA
Tropical Japonica  504 99.20% 0.40% 0.40% 0.00% NA
Japonica Intermediate  241 97.50% 1.20% 0.83% 0.41% NA
VI/Aromatic  96 15.60% 32.30% 37.50% 14.58% NA
Intermediate  90 44.40% 18.90% 27.78% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0822600721 C -> G LOC_Os08g35840.1 upstream_gene_variant ; 699.0bp to feature; MODIFIER silent_mutation Average:42.806; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0822600721 C -> G LOC_Os08g35830.1 downstream_gene_variant ; 2440.0bp to feature; MODIFIER silent_mutation Average:42.806; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0822600721 C -> G LOC_Os08g35840-LOC_Os08g35850 intergenic_region ; MODIFIER silent_mutation Average:42.806; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0822600721 C -> DEL N N silent_mutation Average:42.806; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0822600721 4.65E-06 NA mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 4.99E-06 NA mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 6.39E-07 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 1.59E-06 NA mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 3.33E-06 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 5.14E-06 NA mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 8.28E-06 NA mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 NA 8.08E-46 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 NA 1.56E-56 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 NA 2.67E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 NA 1.89E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 NA 7.73E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 2.44E-07 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 5.23E-08 NA mr1114_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 1.96E-08 NA mr1117_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 4.95E-08 NA mr1119_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 5.84E-07 NA mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 1.66E-06 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 2.50E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 8.84E-08 NA mr1247_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 1.02E-07 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 NA 8.81E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822600721 NA 2.20E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251