Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822365872:

Variant ID: vg0822365872 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 22365872
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGGTCCACGTGGGTTCCACGCTGACTCAACTGCCACGTAGGATAAAACCGGAGTCAAAAACACCAAAGGACCTATCGTGACCGGTTTCGATTAGTTAA[G/A]
GGACGTTGGATATCTGGTTTTGTGGTTATAGGACGATTTTGTAACTCGATGACAAGTCGAGGGACCTTCGGTGTACTTTTTCCTTCCATAATTTCTCAAG

Reverse complement sequence

CTTGAGAAATTATGGAAGGAAAAAGTACACCGAAGGTCCCTCGACTTGTCATCGAGTTACAAAATCGTCCTATAACCACAAAACCAGATATCCAACGTCC[C/T]
TTAACTAATCGAAACCGGTCACGATAGGTCCTTTGGTGTTTTTGACTCCGGTTTTATCCTACGTGGCAGTTGAGTCAGCGTGGAACCCACGTGGACCCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.80% 47.00% 0.17% 0.06% NA
All Indica  2759 88.30% 11.40% 0.22% 0.11% NA
All Japonica  1512 1.10% 98.80% 0.07% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 99.30% 0.30% 0.34% 0.00% NA
Indica II  465 84.70% 14.60% 0.43% 0.22% NA
Indica III  913 88.30% 11.50% 0.11% 0.11% NA
Indica Intermediate  786 82.10% 17.70% 0.13% 0.13% NA
Temperate Japonica  767 1.30% 98.60% 0.13% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 41.10% 57.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0822365872 G -> A LOC_Os08g35500.1 upstream_gene_variant ; 200.0bp to feature; MODIFIER silent_mutation Average:90.68; most accessible tissue: Zhenshan97 panicle, score: 99.105 N N N N
vg0822365872 G -> A LOC_Os08g35480.1 downstream_gene_variant ; 4803.0bp to feature; MODIFIER silent_mutation Average:90.68; most accessible tissue: Zhenshan97 panicle, score: 99.105 N N N N
vg0822365872 G -> A LOC_Os08g35490.1 downstream_gene_variant ; 3004.0bp to feature; MODIFIER silent_mutation Average:90.68; most accessible tissue: Zhenshan97 panicle, score: 99.105 N N N N
vg0822365872 G -> A LOC_Os08g35510.1 downstream_gene_variant ; 3505.0bp to feature; MODIFIER silent_mutation Average:90.68; most accessible tissue: Zhenshan97 panicle, score: 99.105 N N N N
vg0822365872 G -> A LOC_Os08g35500-LOC_Os08g35510 intergenic_region ; MODIFIER silent_mutation Average:90.68; most accessible tissue: Zhenshan97 panicle, score: 99.105 N N N N
vg0822365872 G -> DEL N N silent_mutation Average:90.68; most accessible tissue: Zhenshan97 panicle, score: 99.105 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0822365872 G A 0.02 0.01 0.02 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0822365872 NA 3.31E-47 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 8.47E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 4.89E-28 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 2.53E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 6.44E-15 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 4.79E-08 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 2.22E-10 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 9.73E-06 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 3.00E-58 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 3.70E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 7.63E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 1.23E-31 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 2.91E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 4.68E-08 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 4.23E-09 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 4.62E-06 NA mr1907_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 4.94E-07 2.12E-11 mr1907_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 3.02E-06 5.35E-10 mr1934_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822365872 NA 1.92E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251