Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822330414:

Variant ID: vg0822330414 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 22330414
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

TCATGACGGATCTACTTTTGATAAGCTCTTTTTTTCTAGCATTATGGTGCAAACAGTTTTAAAAAACCTTACATCACTTGGGAGATACTGTTCTTTAAAG[C/T]
TTGACTTTTTTGCAATTTGTCTCTCCACAAGTAGTAATACTATACTATTGCTTGTTACTACTTGTCTGTTGTACGTTACTACAATCGCAACACGATGTTA

Reverse complement sequence

TAACATCGTGTTGCGATTGTAGTAACGTACAACAGACAAGTAGTAACAAGCAATAGTATAGTATTACTACTTGTGGAGAGACAAATTGCAAAAAAGTCAA[G/A]
CTTTAAAGAACAGTATCTCCCAAGTGATGTAAGGTTTTTTAAAACTGTTTGCACCATAATGCTAGAAAAAAAGAGCTTATCAAAAGTAGATCCGTCATGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.00%	6.80%	0.23%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	79.30%	20.10%	0.60%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	98.60%	1.30%	0.13%	0.00%	NA
Tropical Japonica	504	44.20%	54.20%	1.59%	0.00%	NA
Japonica Intermediate	241	91.30%	8.70%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0822330414	C -> T	LOC_Os08g35430.1	upstream_gene_variant ; 2994.0bp to feature; MODIFIER	silent_mutation	Average:37.185; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0822330414	C -> T	LOC_Os08g35440.1	upstream_gene_variant ; 4192.0bp to feature; MODIFIER	silent_mutation	Average:37.185; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0822330414	C -> T	LOC_Os08g35420.1	downstream_gene_variant ; 4721.0bp to feature; MODIFIER	silent_mutation	Average:37.185; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0822330414	C -> T	LOC_Os08g35420-LOC_Os08g35430	intergenic_region ; MODIFIER	silent_mutation	Average:37.185; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0822330414	NA	7.95E-30	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	NA	1.47E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	NA	7.58E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	5.24E-06	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	NA	4.06E-07	mr1221_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	NA	1.66E-19	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	NA	5.37E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	4.44E-06	6.26E-07	mr1600_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	NA	1.64E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	NA	3.32E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	NA	1.23E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	9.85E-06	9.57E-09	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	NA	5.38E-07	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	NA	4.07E-10	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	1.77E-07	NA	mr1916_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	8.80E-06	2.02E-11	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414	NA	1.07E-11	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251