\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822330414:

Variant ID: vg0822330414 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 22330414
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TCATGACGGATCTACTTTTGATAAGCTCTTTTTTTCTAGCATTATGGTGCAAACAGTTTTAAAAAACCTTACATCACTTGGGAGATACTGTTCTTTAAAG[C/T]
TTGACTTTTTTGCAATTTGTCTCTCCACAAGTAGTAATACTATACTATTGCTTGTTACTACTTGTCTGTTGTACGTTACTACAATCGCAACACGATGTTA

Reverse complement sequence

TAACATCGTGTTGCGATTGTAGTAACGTACAACAGACAAGTAGTAACAAGCAATAGTATAGTATTACTACTTGTGGAGAGACAAATTGCAAAAAAGTCAA[G/A]
CTTTAAAGAACAGTATCTCCCAAGTGATGTAAGGTTTTTTAAAACTGTTTGCACCATAATGCTAGAAAAAAAGAGCTTATCAAAAGTAGATCCGTCATGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 6.80% 0.23% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 79.30% 20.10% 0.60% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 98.60% 1.30% 0.13% 0.00% NA
Tropical Japonica  504 44.20% 54.20% 1.59% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0822330414 C -> T LOC_Os08g35430.1 upstream_gene_variant ; 2994.0bp to feature; MODIFIER silent_mutation Average:37.185; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0822330414 C -> T LOC_Os08g35440.1 upstream_gene_variant ; 4192.0bp to feature; MODIFIER silent_mutation Average:37.185; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0822330414 C -> T LOC_Os08g35420.1 downstream_gene_variant ; 4721.0bp to feature; MODIFIER silent_mutation Average:37.185; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0822330414 C -> T LOC_Os08g35420-LOC_Os08g35430 intergenic_region ; MODIFIER silent_mutation Average:37.185; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0822330414 NA 7.95E-30 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 NA 1.47E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 NA 7.58E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 5.24E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 NA 4.06E-07 mr1221_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 NA 1.66E-19 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 NA 5.37E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 4.44E-06 6.26E-07 mr1600_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 NA 1.64E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 NA 3.32E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 NA 1.23E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 9.85E-06 9.57E-09 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 NA 5.38E-07 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 NA 4.07E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 1.77E-07 NA mr1916_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 8.80E-06 2.02E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822330414 NA 1.07E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251