\
| Variant ID: vg0822330414 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 22330414 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 295. )
TCATGACGGATCTACTTTTGATAAGCTCTTTTTTTCTAGCATTATGGTGCAAACAGTTTTAAAAAACCTTACATCACTTGGGAGATACTGTTCTTTAAAG[C/T]
TTGACTTTTTTGCAATTTGTCTCTCCACAAGTAGTAATACTATACTATTGCTTGTTACTACTTGTCTGTTGTACGTTACTACAATCGCAACACGATGTTA
TAACATCGTGTTGCGATTGTAGTAACGTACAACAGACAAGTAGTAACAAGCAATAGTATAGTATTACTACTTGTGGAGAGACAAATTGCAAAAAAGTCAA[G/A]
CTTTAAAGAACAGTATCTCCCAAGTGATGTAAGGTTTTTTAAAACTGTTTGCACCATAATGCTAGAAAAAAAGAGCTTATCAAAAGTAGATCCGTCATGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 6.80% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 79.30% | 20.10% | 0.60% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 44.20% | 54.20% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 11.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0822330414 | C -> T | LOC_Os08g35430.1 | upstream_gene_variant ; 2994.0bp to feature; MODIFIER | silent_mutation | Average:37.185; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0822330414 | C -> T | LOC_Os08g35440.1 | upstream_gene_variant ; 4192.0bp to feature; MODIFIER | silent_mutation | Average:37.185; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0822330414 | C -> T | LOC_Os08g35420.1 | downstream_gene_variant ; 4721.0bp to feature; MODIFIER | silent_mutation | Average:37.185; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0822330414 | C -> T | LOC_Os08g35420-LOC_Os08g35430 | intergenic_region ; MODIFIER | silent_mutation | Average:37.185; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0822330414 | NA | 7.95E-30 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | NA | 1.47E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | NA | 7.58E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | 5.24E-06 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | NA | 4.06E-07 | mr1221_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | NA | 1.66E-19 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | NA | 5.37E-08 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | 4.44E-06 | 6.26E-07 | mr1600_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | NA | 1.64E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | NA | 3.32E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | NA | 1.23E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | 9.85E-06 | 9.57E-09 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | NA | 5.38E-07 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | NA | 4.07E-10 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | 1.77E-07 | NA | mr1916_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | 8.80E-06 | 2.02E-11 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822330414 | NA | 1.07E-11 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |