\
| Variant ID: vg0822230939 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 22230939 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 245. )
TTGTTACTCTTGGGGACTAAGGTCTCCTAGACGGCTAGGCGTCGCCGGTGAGCACCTAAGGTTGTGGTGTGCCACGGAAAGTTTGTGAAGGCTTCGATTT[T/C]
GCCTCCGCAAGGGAAGAAATCAAGAGTGAAACCGAGGAGTGCATTTGTGCAACCTCGTGAGGAAAGGGTTGAAATAGGCCTGGCCCTTGTGGCTCCTCAA
TTGAGGAGCCACAAGGGCCAGGCCTATTTCAACCCTTTCCTCACGAGGTTGCACAAATGCACTCCTCGGTTTCACTCTTGATTTCTTCCCTTGCGGAGGC[A/G]
AAATCGAAGCCTTCACAAACTTTCCGTGGCACACCACAACCTTAGGTGCTCACCGGCGACGCCTAGCCGTCTAGGAGACCTTAGTCCCCAAGAGTAACAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.00% | 36.70% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 97.40% | 2.20% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 1.40% | 98.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 49.10% | 50.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.50% | 0.65% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.10% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 1.20% | 98.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0822230939 | T -> C | LOC_Os08g35220.1 | upstream_gene_variant ; 3452.0bp to feature; MODIFIER | silent_mutation | Average:36.437; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| vg0822230939 | T -> C | LOC_Os08g35230.1 | upstream_gene_variant ; 4020.0bp to feature; MODIFIER | silent_mutation | Average:36.437; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| vg0822230939 | T -> C | LOC_Os08g35220.2 | upstream_gene_variant ; 3478.0bp to feature; MODIFIER | silent_mutation | Average:36.437; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| vg0822230939 | T -> C | LOC_Os08g35220-LOC_Os08g35230 | intergenic_region ; MODIFIER | silent_mutation | Average:36.437; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0822230939 | NA | 6.14E-25 | mr1551 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822230939 | NA | 2.11E-10 | mr1581 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822230939 | 3.21E-06 | NA | mr1047_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822230939 | NA | 7.11E-13 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |