\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822230939:

Variant ID: vg0822230939 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 22230939
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTTACTCTTGGGGACTAAGGTCTCCTAGACGGCTAGGCGTCGCCGGTGAGCACCTAAGGTTGTGGTGTGCCACGGAAAGTTTGTGAAGGCTTCGATTT[T/C]
GCCTCCGCAAGGGAAGAAATCAAGAGTGAAACCGAGGAGTGCATTTGTGCAACCTCGTGAGGAAAGGGTTGAAATAGGCCTGGCCCTTGTGGCTCCTCAA

Reverse complement sequence

TTGAGGAGCCACAAGGGCCAGGCCTATTTCAACCCTTTCCTCACGAGGTTGCACAAATGCACTCCTCGGTTTCACTCTTGATTTCTTCCCTTGCGGAGGC[A/G]
AAATCGAAGCCTTCACAAACTTTCCGTGGCACACCACAACCTTAGGTGCTCACCGGCGACGCCTAGCCGTCTAGGAGACCTTAGTCCCCAAGAGTAACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 36.70% 0.28% 0.00% NA
All Indica  2759 97.40% 2.20% 0.40% 0.00% NA
All Japonica  1512 1.40% 98.50% 0.13% 0.00% NA
Aus  269 49.10% 50.90% 0.00% 0.00% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 97.80% 1.50% 0.65% 0.00% NA
Indica III  913 98.20% 1.50% 0.22% 0.00% NA
Indica Intermediate  786 94.40% 5.10% 0.51% 0.00% NA
Temperate Japonica  767 1.20% 98.60% 0.26% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 56.70% 43.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0822230939 T -> C LOC_Os08g35220.1 upstream_gene_variant ; 3452.0bp to feature; MODIFIER silent_mutation Average:36.437; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg0822230939 T -> C LOC_Os08g35230.1 upstream_gene_variant ; 4020.0bp to feature; MODIFIER silent_mutation Average:36.437; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg0822230939 T -> C LOC_Os08g35220.2 upstream_gene_variant ; 3478.0bp to feature; MODIFIER silent_mutation Average:36.437; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg0822230939 T -> C LOC_Os08g35220-LOC_Os08g35230 intergenic_region ; MODIFIER silent_mutation Average:36.437; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0822230939 NA 6.14E-25 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822230939 NA 2.11E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822230939 3.21E-06 NA mr1047_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822230939 NA 7.11E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251