\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822155831:

Variant ID: vg0822155831 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 22155831
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


AAGATGACGAGAATCTCTTCCAGTTCGAGAGGACGAACTAGATGCATATAAATAAATATTACTCCCTCCATCTATTTTTGATAGTCATATTTCCAAATCT[G/A]
AAAATTTTATTTTTGATAAGCATATTTCAATCCAACGACCTATCATCTTAATGATTTTCTCGAATTTAATGCGTGACTCTCCATTCTTCCATACATGATT

Reverse complement sequence

AATCATGTATGGAAGAATGGAGAGTCACGCATTAAATTCGAGAAAATCATTAAGATGATAGGTCGTTGGATTGAAATATGCTTATCAAAAATAAAATTTT[C/T]
AGATTTGGAAATATGACTATCAAAAATAGATGGAGGGAGTAATATTTATTTATATGCATCTAGTTCGTCCTCTCGAACTGGAAGAGATTCTCGTCATCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 26.60% 3.72% 0.00% NA
All Indica  2759 48.80% 44.90% 6.27% 0.00% NA
All Japonica  1512 99.60% 0.30% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 47.90% 37.30% 14.79% 0.00% NA
Indica II  465 75.50% 20.00% 4.52% 0.00% NA
Indica III  913 31.20% 67.70% 1.10% 0.00% NA
Indica Intermediate  786 54.10% 39.10% 6.87% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 88.90% 8.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0822155831 G -> A LOC_Os08g35140.1 upstream_gene_variant ; 4968.0bp to feature; MODIFIER silent_mutation Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979 N N N N
vg0822155831 G -> A LOC_Os08g35150.1 upstream_gene_variant ; 1001.0bp to feature; MODIFIER silent_mutation Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979 N N N N
vg0822155831 G -> A LOC_Os08g35160.1 upstream_gene_variant ; 3775.0bp to feature; MODIFIER silent_mutation Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979 N N N N
vg0822155831 G -> A LOC_Os08g35160.2 upstream_gene_variant ; 3677.0bp to feature; MODIFIER silent_mutation Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979 N N N N
vg0822155831 G -> A LOC_Os08g35160.3 upstream_gene_variant ; 3775.0bp to feature; MODIFIER silent_mutation Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979 N N N N
vg0822155831 G -> A LOC_Os08g35150-LOC_Os08g35160 intergenic_region ; MODIFIER silent_mutation Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0822155831 NA 1.02E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822155831 1.77E-06 NA mr1469_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822155831 3.25E-06 3.07E-08 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251