\
| Variant ID: vg0822155831 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 22155831 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 120. )
AAGATGACGAGAATCTCTTCCAGTTCGAGAGGACGAACTAGATGCATATAAATAAATATTACTCCCTCCATCTATTTTTGATAGTCATATTTCCAAATCT[G/A]
AAAATTTTATTTTTGATAAGCATATTTCAATCCAACGACCTATCATCTTAATGATTTTCTCGAATTTAATGCGTGACTCTCCATTCTTCCATACATGATT
AATCATGTATGGAAGAATGGAGAGTCACGCATTAAATTCGAGAAAATCATTAAGATGATAGGTCGTTGGATTGAAATATGCTTATCAAAAATAAAATTTT[C/T]
AGATTTGGAAATATGACTATCAAAAATAGATGGAGGGAGTAATATTTATTTATATGCATCTAGTTCGTCCTCTCGAACTGGAAGAGATTCTCGTCATCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.70% | 26.60% | 3.72% | 0.00% | NA |
| All Indica | 2759 | 48.80% | 44.90% | 6.27% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 47.90% | 37.30% | 14.79% | 0.00% | NA |
| Indica II | 465 | 75.50% | 20.00% | 4.52% | 0.00% | NA |
| Indica III | 913 | 31.20% | 67.70% | 1.10% | 0.00% | NA |
| Indica Intermediate | 786 | 54.10% | 39.10% | 6.87% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 8.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0822155831 | G -> A | LOC_Os08g35140.1 | upstream_gene_variant ; 4968.0bp to feature; MODIFIER | silent_mutation | Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979 | N | N | N | N |
| vg0822155831 | G -> A | LOC_Os08g35150.1 | upstream_gene_variant ; 1001.0bp to feature; MODIFIER | silent_mutation | Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979 | N | N | N | N |
| vg0822155831 | G -> A | LOC_Os08g35160.1 | upstream_gene_variant ; 3775.0bp to feature; MODIFIER | silent_mutation | Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979 | N | N | N | N |
| vg0822155831 | G -> A | LOC_Os08g35160.2 | upstream_gene_variant ; 3677.0bp to feature; MODIFIER | silent_mutation | Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979 | N | N | N | N |
| vg0822155831 | G -> A | LOC_Os08g35160.3 | upstream_gene_variant ; 3775.0bp to feature; MODIFIER | silent_mutation | Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979 | N | N | N | N |
| vg0822155831 | G -> A | LOC_Os08g35150-LOC_Os08g35160 | intergenic_region ; MODIFIER | silent_mutation | Average:64.27; most accessible tissue: Minghui63 flower, score: 78.979 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0822155831 | NA | 1.02E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822155831 | 1.77E-06 | NA | mr1469_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822155831 | 3.25E-06 | 3.07E-08 | mr1469_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |