\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822138203:

Variant ID: vg0822138203 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 22138203
Reference Allele: AAlternative Allele: G,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCAAAAAAAAAAGTGGCTATATTTAGTTTGCTACCAAATTTTAATAACTATATAAGAAATCCTGCTAAAATTTTGATAAGTTATCAAAATTTTGACAAT[A/G,C]
TTTTTTTTAGCATCAAAGTGAACATGTCTCAAGTATTGGTCCATACATATCTTGTAAAGCAGGCATGTTATGTATTCTACTCTTTCCTTATTTCCCTTAT

Reverse complement sequence

ATAAGGGAAATAAGGAAAGAGTAGAATACATAACATGCCTGCTTTACAAGATATGTATGGACCAATACTTGAGACATGTTCACTTTGATGCTAAAAAAAA[T/C,G]
ATTGTCAAAATTTTGATAACTTATCAAAATTTTAGCAGGATTTCTTATATAGTTATTAAAATTTGGTAGCAAACTAAATATAGCCACTTTTTTTTTTGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.80% 37.80% 1.33% 0.00% C: 0.06%
All Indica  2759 95.00% 3.00% 1.99% 0.00% NA
All Japonica  1512 1.30% 98.50% 0.13% 0.00% C: 0.07%
Aus  269 40.10% 59.90% 0.00% 0.00% NA
Indica I  595 99.00% 0.00% 1.01% 0.00% NA
Indica II  465 92.30% 1.50% 6.24% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 89.60% 7.90% 2.54% 0.00% NA
Temperate Japonica  767 1.30% 98.60% 0.13% 0.00% NA
Tropical Japonica  504 0.80% 98.80% 0.20% 0.00% C: 0.20%
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 46.70% 44.40% 6.67% 0.00% C: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0822138203 A -> G LOC_Os08g35110.1 downstream_gene_variant ; 324.0bp to feature; MODIFIER silent_mutation Average:60.511; most accessible tissue: Callus, score: 89.593 N N N N
vg0822138203 A -> G LOC_Os08g35110-LOC_Os08g35120 intergenic_region ; MODIFIER silent_mutation Average:60.511; most accessible tissue: Callus, score: 89.593 N N N N
vg0822138203 A -> C LOC_Os08g35110.1 downstream_gene_variant ; 324.0bp to feature; MODIFIER silent_mutation Average:60.511; most accessible tissue: Callus, score: 89.593 N N N N
vg0822138203 A -> C LOC_Os08g35110-LOC_Os08g35120 intergenic_region ; MODIFIER silent_mutation Average:60.511; most accessible tissue: Callus, score: 89.593 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0822138203 NA 4.92E-48 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 1.04E-25 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 3.78E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 2.56E-17 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 2.01E-31 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 3.32E-28 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 6.70E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 5.26E-47 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 1.10E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 9.41E-25 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 2.48E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 2.08E-44 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 9.12E-50 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 2.27E-21 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 8.36E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 2.72E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 1.24E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 4.41E-37 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 3.64E-28 mr1841 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 6.66E-14 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 9.62E-21 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 1.84E-59 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 1.09E-16 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 3.04E-29 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 1.02E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203 NA 3.62E-45 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251