Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822138203:

Variant ID: vg0822138203 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 22138203
Reference Allele: A	Alternative Allele: G,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCAAAAAAAAAAGTGGCTATATTTAGTTTGCTACCAAATTTTAATAACTATATAAGAAATCCTGCTAAAATTTTGATAAGTTATCAAAATTTTGACAAT[A/G,C]
TTTTTTTTAGCATCAAAGTGAACATGTCTCAAGTATTGGTCCATACATATCTTGTAAAGCAGGCATGTTATGTATTCTACTCTTTCCTTATTTCCCTTAT

Reverse complement sequence

ATAAGGGAAATAAGGAAAGAGTAGAATACATAACATGCCTGCTTTACAAGATATGTATGGACCAATACTTGAGACATGTTCACTTTGATGCTAAAAAAAA[T/C,G]
ATTGTCAAAATTTTGATAACTTATCAAAATTTTAGCAGGATTTCTTATATAGTTATTAAAATTTGGTAGCAAACTAAATATAGCCACTTTTTTTTTTGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.80%	37.80%	1.33%	0.00%	C: 0.06%
All Indica	2759	95.00%	3.00%	1.99%	0.00%	NA
All Japonica	1512	1.30%	98.50%	0.13%	0.00%	C: 0.07%
Aus	269	40.10%	59.90%	0.00%	0.00%	NA
Indica I	595	99.00%	0.00%	1.01%	0.00%	NA
Indica II	465	92.30%	1.50%	6.24%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	89.60%	7.90%	2.54%	0.00%	NA
Temperate Japonica	767	1.30%	98.60%	0.13%	0.00%	NA
Tropical Japonica	504	0.80%	98.80%	0.20%	0.00%	C: 0.20%
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	46.70%	44.40%	6.67%	0.00%	C: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0822138203	A -> G	LOC_Os08g35110.1	downstream_gene_variant ; 324.0bp to feature; MODIFIER	silent_mutation	Average:60.511; most accessible tissue: Callus, score: 89.593	N	N	N	N
vg0822138203	A -> G	LOC_Os08g35110-LOC_Os08g35120	intergenic_region ; MODIFIER	silent_mutation	Average:60.511; most accessible tissue: Callus, score: 89.593	N	N	N	N
vg0822138203	A -> C	LOC_Os08g35110.1	downstream_gene_variant ; 324.0bp to feature; MODIFIER	silent_mutation	Average:60.511; most accessible tissue: Callus, score: 89.593	N	N	N	N
vg0822138203	A -> C	LOC_Os08g35110-LOC_Os08g35120	intergenic_region ; MODIFIER	silent_mutation	Average:60.511; most accessible tissue: Callus, score: 89.593	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0822138203	NA	4.92E-48	mr1125	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	1.04E-25	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	3.78E-17	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	2.56E-17	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	2.01E-31	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	3.32E-28	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	6.70E-10	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	5.26E-47	mr1519	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	1.10E-24	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	9.41E-25	mr1551	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	2.48E-09	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	2.08E-44	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	9.12E-50	mr1599	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	2.27E-21	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	8.36E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	2.72E-29	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	1.24E-11	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	4.41E-37	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	3.64E-28	mr1841	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	6.66E-14	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	9.62E-21	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	1.84E-59	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	1.09E-16	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	3.04E-29	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	1.02E-21	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822138203	NA	3.62E-45	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251