\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0822115787:

Variant ID: vg0822115787 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 22115787
Reference Allele: GAlternative Allele: A,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCTTACGTCTTCTTTGTACTTTAACCTTTTTCCTCACTGTCATCGCCGGATATCGAAATTCAATAGGCCAAATTTAGGGGAAAATAAGCAATCACAAAC[G/A,T]
TGGTGAAAACTTGAAAACTACCGTTGGATCGAGAAATGAACATCCGAGATTCGTTCACGTCATCATGAGTAAAAATTTTACTCCCAACAAAATTTTTTAC

Reverse complement sequence

GTAAAAAATTTTGTTGGGAGTAAAATTTTTACTCATGATGACGTGAACGAATCTCGGATGTTCATTTCTCGATCCAACGGTAGTTTTCAAGTTTTCACCA[C/T,A]
GTTTGTGATTGCTTATTTTCCCCTAAATTTGGCCTATTGAATTTCGATATCCGGCGATGACAGTGAGGAAAAAGGTTAAAGTACAAAGAAGACGTAAGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 37.70% 0.04% 0.00% T: 0.02%
All Indica  2759 97.30% 2.70% 0.00% 0.00% NA
All Japonica  1512 1.50% 98.40% 0.07% 0.00% T: 0.07%
Aus  269 39.40% 60.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 1.30% 98.60% 0.13% 0.00% NA
Tropical Japonica  504 1.00% 98.80% 0.00% 0.00% T: 0.20%
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0822115787 G -> T LOC_Os08g35090.1 downstream_gene_variant ; 1916.0bp to feature; MODIFIER silent_mutation Average:63.187; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0822115787 G -> T LOC_Os08g35090-LOC_Os08g35100 intergenic_region ; MODIFIER silent_mutation Average:63.187; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0822115787 G -> A LOC_Os08g35090.1 downstream_gene_variant ; 1916.0bp to feature; MODIFIER silent_mutation Average:63.187; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0822115787 G -> A LOC_Os08g35090-LOC_Os08g35100 intergenic_region ; MODIFIER silent_mutation Average:63.187; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0822115787 NA 1.10E-46 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 4.54E-48 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 4.11E-33 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 1.36E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 1.83E-17 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 2.54E-32 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 2.74E-25 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 7.20E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 2.79E-50 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 2.66E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 3.81E-31 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 4.89E-12 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 1.27E-36 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 3.87E-25 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 2.70E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 5.58E-63 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 1.97E-22 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 1.09E-44 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 2.03E-59 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 4.10E-19 mr1578_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 8.40E-46 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 3.46E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822115787 NA 5.74E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251