RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0821970212:

Variant ID: vg0821970212 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 21970212
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

GCCACACGTTTAGGCGTAGTTGAATGATATGAAGATTTAGCAAAACTATCGATATCCTACGATATTTGGATAGTGATAACTTGCTAGTTCTTGTGGGAAT[C/A]
AAGCAATCCATGGTATGAAAATTTTGCTTGAACCATCAAGCAATTAGGAAAAACTGGGGCAAGATTTCACAGGTTGTGAAATATATTTTGTCAAATCAGG

Reverse complement sequence

CCTGATTTGACAAAATATATTTCACAACCTGTGAAATCTTGCCCCAGTTTTTCCTAATTGCTTGATGGTTCAAGCAAAATTTTCATACCATGGATTGCTT[G/T]
ATTCCCACAAGAACTAGCAAGTTATCACTATCCAAATATCGTAGGATATCGATAGTTTTGCTAAATCTTCATATCATTCAACTACGCCTAAACGTGTGGC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.90%	19.70%	2.96%	0.38%	NA
All Indica	2759	62.60%	32.70%	4.78%	0.00%	NA
All Japonica	1512	97.90%	0.90%	0.13%	1.12%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	44.40%	43.40%	12.27%	0.00%	NA
Indica II	465	27.50%	65.80%	6.67%	0.00%	NA
Indica III	913	90.70%	9.30%	0.00%	0.00%	NA
Indica Intermediate	786	64.40%	32.10%	3.56%	0.00%	NA
Temperate Japonica	767	96.50%	1.00%	0.26%	2.22%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	72.20%	20.00%	6.67%	1.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0821970212	C -> A	LOC_Os08g34890.1	downstream_gene_variant ; 444.0bp to feature; MODIFIER	silent_mutation	Average:45.789; most accessible tissue: Callus, score: 77.046	N	N	N	N
vg0821970212	C -> A	LOC_Os08g34895.1	downstream_gene_variant ; 3342.0bp to feature; MODIFIER	silent_mutation	Average:45.789; most accessible tissue: Callus, score: 77.046	N	N	N	N
vg0821970212	C -> A	LOC_Os08g34890-LOC_Os08g34895	intergenic_region ; MODIFIER	silent_mutation	Average:45.789; most accessible tissue: Callus, score: 77.046	N	N	N	N
vg0821970212	C -> DEL	N	N	silent_mutation	Average:45.789; most accessible tissue: Callus, score: 77.046	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0821970212	NA	4.88E-18	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0821970212	NA	8.13E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821970212	NA	2.55E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821970212	NA	2.15E-10	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821970212	NA	1.94E-16	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821970212	NA	5.42E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821970212	NA	5.16E-14	mr1218	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821970212	NA	9.11E-07	mr1218	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821970212	NA	2.30E-10	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821970212	NA	5.46E-15	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 136 entries

Previous1 2 3 4 5…14Next

Search for Variation information by Variation ID:

Detailed information for vg0821970212:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact