Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821932616:

Variant ID: vg0821932616 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 21932616
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAAAACTCGGATGAAACAAAGATGGCGGAGAAGAACGAAGGAGCTGAGCTTTTGTGGATTGAAGGCACATCATAATAAGGGAACGACGACGATGATTTC[G/A]
CGTAACAGACACCGGGAGTAACTATGTTAATGGCAGCCATCAATGACCTCGTTGGTGAGCGTGGAGAAAGAATCGCCGGGGAGGGGGAGGCGGAGGAGAA

Reverse complement sequence

TTCTCCTCCGCCTCCCCCTCCCCGGCGATTCTTTCTCCACGCTCACCAACGAGGTCATTGATGGCTGCCATTAACATAGTTACTCCCGGTGTCTGTTACG[C/T]
GAAATCATCGTCGTCGTTCCCTTATTATGATGTGCCTTCAATCCACAAAAGCTCAGCTCCTTCGTTCTTCTCCGCCATCTTTGTTTCATCCGAGTTTTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 7.40% 5.44% 8.76% NA
All Indica  2759 79.20% 12.70% 7.94% 0.18% NA
All Japonica  1512 71.30% 0.00% 2.25% 26.46% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 68.40% 11.80% 19.83% 0.00% NA
Indica II  465 93.50% 3.20% 3.01% 0.22% NA
Indica III  913 80.70% 17.30% 1.75% 0.22% NA
Indica Intermediate  786 77.00% 13.70% 9.03% 0.25% NA
Temperate Japonica  767 98.70% 0.00% 0.39% 0.91% NA
Tropical Japonica  504 27.40% 0.00% 4.37% 68.25% NA
Japonica Intermediate  241 75.90% 0.00% 3.73% 20.33% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 0.00% 4.44% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821932616 G -> A LOC_Os08g34850.1 missense_variant ; p.Ala14Val; MODERATE nonsynonymous_codon ; A14V Average:63.511; most accessible tissue: Zhenshan97 panicle, score: 76.605 unknown unknown DELETERIOUS 0.01
vg0821932616 G -> DEL LOC_Os08g34850.1 N frameshift_variant Average:63.511; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0821932616 NA 6.13E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 7.07E-09 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 3.05E-08 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 3.00E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 7.32E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 2.93E-07 mr1208_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 7.74E-10 mr1232_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 1.92E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 4.66E-06 mr1505_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 9.26E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 9.92E-06 mr1511_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 1.86E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 5.10E-07 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 2.42E-06 mr1566_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 6.80E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 6.39E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 8.90E-07 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 6.94E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 9.98E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 8.91E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 6.92E-06 mr1661_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 5.29E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 9.10E-07 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 8.70E-06 mr1787_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 3.40E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 2.35E-06 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 6.44E-07 mr1862_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 3.75E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 7.01E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 5.37E-07 mr1954_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821932616 NA 4.94E-07 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251