Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821911860:

Variant ID: vg0821911860 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 21911860
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

ACCCAGTGGCGGATCCAGGAAAAAAAAGTAGTGGGGGCTGAACTAACTAAGCCAGCATAAATCGAAACATCTCACATATAAATTGGCTACATGTATAGTT[C/A]
AAAGTAGACACGTCAAATTAATGATAAGTAGAGAATTTTGTCCATACCAAACCAATATCCAATAGATGATGTTTCACTGCCAGTCACTTATTATTCTTCA

Reverse complement sequence

TGAAGAATAATAAGTGACTGGCAGTGAAACATCATCTATTGGATATTGGTTTGGTATGGACAAAATTCTCTACTTATCATTAATTTGACGTGTCTACTTT[G/T]
AACTATACATGTAGCCAATTTATATGTGAGATGTTTCGATTTATGCTGGCTTAGTTAGTTCAGCCCCCACTACTTTTTTTTCCTGGATCCGCCACTGGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.90%	34.70%	1.33%	8.10%	NA
All Indica	2759	93.50%	6.20%	0.07%	0.22%	NA
All Japonica	1512	1.70%	70.00%	3.90%	24.34%	NA
Aus	269	0.00%	100.00%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	97.60%	2.20%	0.00%	0.22%	NA
Indica III	913	93.00%	6.60%	0.22%	0.22%	NA
Indica Intermediate	786	88.20%	11.50%	0.00%	0.38%	NA
Temperate Japonica	767	1.60%	97.30%	0.39%	0.78%	NA
Tropical Japonica	504	1.40%	27.40%	8.73%	62.50%	NA
Japonica Intermediate	241	2.90%	72.60%	4.98%	19.50%	NA
VI/Aromatic	96	0.00%	99.00%	0.00%	1.04%	NA
Intermediate	90	38.90%	50.00%	2.22%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0821911860	C -> A	LOC_Os08g34820.1	upstream_gene_variant ; 3585.0bp to feature; MODIFIER	silent_mutation	Average:45.226; most accessible tissue: Zhenshan97 flower, score: 63.345	N	N	N	N
vg0821911860	C -> A	LOC_Os08g34840.1	upstream_gene_variant ; 4904.0bp to feature; MODIFIER	silent_mutation	Average:45.226; most accessible tissue: Zhenshan97 flower, score: 63.345	N	N	N	N
vg0821911860	C -> A	LOC_Os08g34830.1	downstream_gene_variant ; 435.0bp to feature; MODIFIER	silent_mutation	Average:45.226; most accessible tissue: Zhenshan97 flower, score: 63.345	N	N	N	N
vg0821911860	C -> A	LOC_Os08g34820-LOC_Os08g34830	intergenic_region ; MODIFIER	silent_mutation	Average:45.226; most accessible tissue: Zhenshan97 flower, score: 63.345	N	N	N	N
vg0821911860	C -> DEL	N	N	silent_mutation	Average:45.226; most accessible tissue: Zhenshan97 flower, score: 63.345	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0821911860	NA	1.51E-10	mr1342	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821911860	NA	5.34E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251