Variant ID: vg0821901209 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 21901209 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAACACTCCCCCCTTAACGTCTTTGCATTTCCTCCCTCCTCCAATCTCATTCGATATGGTGAGGTTTTTTTTTCGAGTGGACCAATGTGGTGAGGTCACG[A/G]
CGAAGAGATTAAAACGTCGGAATATAAGCGAGTGAAAACAAATAGGAAATATATGTTATATATATGTGAGAAAGCTTTTTTCTACAAAATGTAAGCTAAT
ATTAGCTTACATTTTGTAGAAAAAAGCTTTCTCACATATATATAACATATATTTCCTATTTGTTTTCACTCGCTTATATTCCGACGTTTTAATCTCTTCG[T/C]
CGTGACCTCACCACATTGGTCCACTCGAAAAAAAAACCTCACCATATCGAATGAGATTGGAGGAGGGAGGAAATGCAAAGACGTTAAGGGGGGAGTGTTG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 79.10% | 10.50% | 0.61% | 9.78% | NA |
All Indica | 2759 | 99.60% | 0.10% | 0.00% | 0.25% | NA |
All Japonica | 1512 | 36.80% | 32.00% | 1.79% | 29.37% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.20% | 0.00% | 0.22% | NA |
Indica III | 913 | 99.70% | 0.00% | 0.00% | 0.33% | NA |
Indica Intermediate | 786 | 99.40% | 0.30% | 0.00% | 0.38% | NA |
Temperate Japonica | 767 | 36.60% | 59.30% | 2.74% | 1.30% | NA |
Tropical Japonica | 504 | 23.00% | 1.40% | 0.99% | 74.60% | NA |
Japonica Intermediate | 241 | 66.40% | 9.10% | 0.41% | 24.07% | NA |
VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
Intermediate | 90 | 76.70% | 10.00% | 2.22% | 11.11% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0821901209 | A -> G | LOC_Os08g34820.1 | downstream_gene_variant ; 4325.0bp to feature; MODIFIER | silent_mutation | Average:34.907; most accessible tissue: Callus, score: 62.574 | N | N | N | N |
vg0821901209 | A -> G | LOC_Os08g34810-LOC_Os08g34820 | intergenic_region ; MODIFIER | silent_mutation | Average:34.907; most accessible tissue: Callus, score: 62.574 | N | N | N | N |
vg0821901209 | A -> DEL | N | N | silent_mutation | Average:34.907; most accessible tissue: Callus, score: 62.574 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0821901209 | NA | 2.20E-14 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0821901209 | NA | 2.91E-07 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0821901209 | NA | 3.84E-10 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0821901209 | NA | 3.59E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0821901209 | NA | 6.66E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0821901209 | NA | 2.85E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0821901209 | NA | 6.13E-06 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0821901209 | NA | 3.41E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0821901209 | NA | 8.24E-06 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0821901209 | NA | 8.09E-07 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/