\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821888365:

Variant ID: vg0821888365 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 21888365
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGAAGATGTTCCAAGTTTCTGATTATCTTAGCTATAAATGATCCATACAAACATTGTCATTGAAATAGTTATGCATAGAAAACGTATATTATGATTATA[T/A]
TTTTTTTTCACCGATTGCAATGCACGGACATTTTCGCTAGTTATTATAAAAGTTCAAGGTGTTTTTGTCTCAAATCTTCGTACGCCGTCCGAATTTTTTT

Reverse complement sequence

AAAAAAATTCGGACGGCGTACGAAGATTTGAGACAAAAACACCTTGAACTTTTATAATAACTAGCGAAAATGTCCGTGCATTGCAATCGGTGAAAAAAAA[A/T]
TATAATCATAATATACGTTTTCTATGCATAACTATTTCAATGACAATGTTTGTATGGATCATTTATAGCTAAGATAATCAGAAACTTGGAACATCTTCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 10.50% 0.72% 9.78% NA
All Indica  2759 99.50% 0.20% 0.00% 0.25% NA
All Japonica  1512 37.00% 31.70% 2.05% 29.23% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.00% 0.22% NA
Indica III  913 99.70% 0.00% 0.00% 0.33% NA
Indica Intermediate  786 99.40% 0.30% 0.00% 0.38% NA
Temperate Japonica  767 36.80% 58.80% 3.39% 1.04% NA
Tropical Japonica  504 23.40% 1.40% 0.60% 74.60% NA
Japonica Intermediate  241 66.40% 8.70% 0.83% 24.07% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 73.30% 10.00% 3.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821888365 T -> A LOC_Os08g34800.1 downstream_gene_variant ; 3104.0bp to feature; MODIFIER silent_mutation Average:65.348; most accessible tissue: Zhenshan97 root, score: 89.469 N N N N
vg0821888365 T -> A LOC_Os08g34810.1 downstream_gene_variant ; 1063.0bp to feature; MODIFIER silent_mutation Average:65.348; most accessible tissue: Zhenshan97 root, score: 89.469 N N N N
vg0821888365 T -> A LOC_Os08g34800-LOC_Os08g34810 intergenic_region ; MODIFIER silent_mutation Average:65.348; most accessible tissue: Zhenshan97 root, score: 89.469 N N N N
vg0821888365 T -> DEL N N silent_mutation Average:65.348; most accessible tissue: Zhenshan97 root, score: 89.469 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0821888365 NA 2.87E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0821888365 NA 7.42E-16 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0821888365 NA 2.74E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 5.08E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 3.58E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 4.50E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 6.03E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 6.33E-12 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 2.97E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 5.94E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 4.64E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 2.60E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 8.00E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 5.12E-06 6.84E-27 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 3.56E-10 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 6.04E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 5.02E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 1.06E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 1.97E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 1.31E-07 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 1.89E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 7.99E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 4.54E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 2.97E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 1.84E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 1.04E-06 1.49E-17 mr1182_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 2.59E-10 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 8.73E-13 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 5.91E-08 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 2.36E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 3.71E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 6.29E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 3.77E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 1.95E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821888365 NA 2.36E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251