\
| Variant ID: vg0821781292 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 21781292 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 173. )
TATCCACCTTGCCTTCGAAATCGCGCAATCTAGAAAACCGATTTTGCTCGGGGGGCAAGACATTAATATGCTCGTGAAGAAACCAAGAGAAGATGAACGG[C/T]
GATGGATACAACATCACATCTTTGAGCCGCCGTTTGTTGGATGCTAAGGCAAGGTATGGGTTTGTTGTGTTCAACATTATATTATATGCCTATGCCATGA
TCATGGCATAGGCATATAATATAATGTTGAACACAACAAACCCATACCTTGCCTTAGCATCCAACAAACGGCGGCTCAAAGATGTGATGTTGTATCCATC[G/A]
CCGTTCATCTTCTCTTGGTTTCTTCACGAGCATATTAATGTCTTGCCCCCCGAGCAAAATCGGTTTTCTAGATTGCGCGATTTCGAAGGCAAGGTGGATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.10% | 28.00% | 0.66% | 0.23% | NA |
| All Indica | 2759 | 97.80% | 0.80% | 1.05% | 0.40% | NA |
| All Japonica | 1512 | 17.20% | 82.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.20% | 0.34% | 0.67% | NA |
| Indica II | 465 | 98.50% | 1.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.10% | 0.50% | 2.63% | 0.77% | NA |
| Indica Intermediate | 786 | 98.50% | 1.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 11.30% | 88.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 12.90% | 87.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.80% | 54.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 45.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0821781292 | C -> T | LOC_Os08g34670.1 | downstream_gene_variant ; 570.0bp to feature; MODIFIER | silent_mutation | Average:29.069; most accessible tissue: Minghui63 flower, score: 40.98 | N | N | N | N |
| vg0821781292 | C -> T | LOC_Os08g34680.1 | downstream_gene_variant ; 2873.0bp to feature; MODIFIER | silent_mutation | Average:29.069; most accessible tissue: Minghui63 flower, score: 40.98 | N | N | N | N |
| vg0821781292 | C -> T | LOC_Os08g34670-LOC_Os08g34680 | intergenic_region ; MODIFIER | silent_mutation | Average:29.069; most accessible tissue: Minghui63 flower, score: 40.98 | N | N | N | N |
| vg0821781292 | C -> DEL | N | N | silent_mutation | Average:29.069; most accessible tissue: Minghui63 flower, score: 40.98 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0821781292 | 4.40E-06 | NA | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821781292 | 8.23E-07 | 1.42E-06 | mr1246 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821781292 | NA | 2.15E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821781292 | NA | 2.72E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |