\
| Variant ID: vg0821779217 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 21779217 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )
ATGGCCAAATATTTCTTAATGTTGATCATGTGTCATGAAGCTCTGGCTCAGGAAAGCCGAGTGGATAATAATAACTTAAATGCTAGTTTAGATGATAGTG[C/T]
AATATCATGTGTAGCCGAACCAAATGACGGTTCGGATTGTGTTAATAATTTGTGCAATGATGCCATAGCAATTATAGCCGAACCAAATGTTGGTTCGGAT
ATCCGAACCAACATTTGGTTCGGCTATAATTGCTATGGCATCATTGCACAAATTATTAACACAATCCGAACCGTCATTTGGTTCGGCTACACATGATATT[G/A]
CACTATCATCTAAACTAGCATTTAAGTTATTATTATCCACTCGGCTTTCCTGAGCCAGAGCTTCATGACACATGATCAACATTAAGAAATATTTGGCCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 9.10% | 1.02% | 0.74% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 67.60% | 27.10% | 2.98% | 2.31% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 17.70% | 67.70% | 7.94% | 6.75% | NA |
| Japonica Intermediate | 241 | 72.20% | 25.30% | 2.07% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0821779217 | C -> T | LOC_Os08g34680.1 | downstream_gene_variant ; 4948.0bp to feature; MODIFIER | silent_mutation | Average:33.646; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0821779217 | C -> T | LOC_Os08g34670.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.646; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0821779217 | C -> DEL | N | N | silent_mutation | Average:33.646; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0821779217 | NA | 1.63E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 2.99E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 4.74E-19 | mr1518 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 7.80E-08 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 1.50E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 4.11E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 3.63E-20 | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 1.17E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | 9.94E-07 | 1.68E-40 | mr1699 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 5.03E-21 | mr1699 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 5.35E-15 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 2.18E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 3.98E-08 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 2.29E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 4.78E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 4.40E-23 | mr1676_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 9.41E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 5.73E-34 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 1.55E-16 | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 1.44E-11 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 3.82E-14 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821779217 | NA | 1.02E-20 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |