\
| Variant ID: vg0821683762 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 21683762 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAGTAAATTTTTCAGATCCGAAAATATGCCTATCAAAAGTAGATTGAGAGAGTATATTTGTAGCTAAATATTATATGAGTTAACTATTAGATTGACTATA[T/G]
ATGATTTGTAGTAAGTAGTTAGCTATACTATTAAACTTGCTCTAAGACACACTTAGATATGTATGCTTCTTCCCAATTAACCTAACAGGCCAACGTTAGC
GCTAACGTTGGCCTGTTAGGTTAATTGGGAAGAAGCATACATATCTAAGTGTGTCTTAGAGCAAGTTTAATAGTATAGCTAACTACTTACTACAAATCAT[A/C]
TATAGTCAATCTAATAGTTAACTCATATAATATTTAGCTACAAATATACTCTCTCAATCTACTTTTGATAGGCATATTTTCGGATCTGAAAAATTTACTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.50% | 23.10% | 0.00% | 1.42% | NA |
| All Indica | 2759 | 99.40% | 0.50% | 0.00% | 0.04% | NA |
| All Japonica | 1512 | 27.10% | 68.70% | 0.00% | 4.23% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 65.10% | 26.00% | 0.00% | 8.93% | NA |
| Japonica Intermediate | 241 | 26.60% | 65.60% | 0.00% | 7.88% | NA |
| VI/Aromatic | 96 | 86.50% | 11.50% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0821683762 | T -> G | LOC_Os08g34540.1 | upstream_gene_variant ; 2016.0bp to feature; MODIFIER | silent_mutation | Average:58.4; most accessible tissue: Callus, score: 97.995 | N | N | N | N |
| vg0821683762 | T -> G | LOC_Os08g34540-LOC_Os08g34550 | intergenic_region ; MODIFIER | silent_mutation | Average:58.4; most accessible tissue: Callus, score: 97.995 | N | N | N | N |
| vg0821683762 | T -> DEL | N | N | silent_mutation | Average:58.4; most accessible tissue: Callus, score: 97.995 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0821683762 | NA | 1.38E-35 | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0821683762 | NA | 1.02E-14 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821683762 | NA | 1.59E-09 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821683762 | NA | 6.13E-07 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821683762 | NA | 3.14E-23 | mr1862 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821683762 | NA | 2.69E-15 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821683762 | 1.85E-06 | NA | mr1335_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |