\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821683762:

Variant ID: vg0821683762 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 21683762
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTAAATTTTTCAGATCCGAAAATATGCCTATCAAAAGTAGATTGAGAGAGTATATTTGTAGCTAAATATTATATGAGTTAACTATTAGATTGACTATA[T/G]
ATGATTTGTAGTAAGTAGTTAGCTATACTATTAAACTTGCTCTAAGACACACTTAGATATGTATGCTTCTTCCCAATTAACCTAACAGGCCAACGTTAGC

Reverse complement sequence

GCTAACGTTGGCCTGTTAGGTTAATTGGGAAGAAGCATACATATCTAAGTGTGTCTTAGAGCAAGTTTAATAGTATAGCTAACTACTTACTACAAATCAT[A/C]
TATAGTCAATCTAATAGTTAACTCATATAATATTTAGCTACAAATATACTCTCTCAATCTACTTTTGATAGGCATATTTTCGGATCTGAAAAATTTACTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.50% 23.10% 0.00% 1.42% NA
All Indica  2759 99.40% 0.50% 0.00% 0.04% NA
All Japonica  1512 27.10% 68.70% 0.00% 4.23% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 98.90% 1.10% 0.00% 0.00% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 65.10% 26.00% 0.00% 8.93% NA
Japonica Intermediate  241 26.60% 65.60% 0.00% 7.88% NA
VI/Aromatic  96 86.50% 11.50% 0.00% 2.08% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821683762 T -> G LOC_Os08g34540.1 upstream_gene_variant ; 2016.0bp to feature; MODIFIER silent_mutation Average:58.4; most accessible tissue: Callus, score: 97.995 N N N N
vg0821683762 T -> G LOC_Os08g34540-LOC_Os08g34550 intergenic_region ; MODIFIER silent_mutation Average:58.4; most accessible tissue: Callus, score: 97.995 N N N N
vg0821683762 T -> DEL N N silent_mutation Average:58.4; most accessible tissue: Callus, score: 97.995 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0821683762 NA 1.38E-35 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0821683762 NA 1.02E-14 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821683762 NA 1.59E-09 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821683762 NA 6.13E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821683762 NA 3.14E-23 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821683762 NA 2.69E-15 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821683762 1.85E-06 NA mr1335_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251