Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821671221:

Variant ID: vg0821671221 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 21671221
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTTATTCTTACTTTTTTTAATAGTTACAAAATATATATGAAGAAATGTTTTAACATGAAGGCTTGCAAGCCAGTTCGAGCTAGCTCGAGCCAGGAAAC[G/A]
AGCCGAGCCAAGCTCAAGTTTTAGCTTGTTTCGCTAACCGAGCCAAGCCAAGCCAAACCTAGTTTGTTAGGAGCCACTACAAGCCGAGCCGAGCCAGGCT

Reverse complement sequence

AGCCTGGCTCGGCTCGGCTTGTAGTGGCTCCTAACAAACTAGGTTTGGCTTGGCTTGGCTCGGTTAGCGAAACAAGCTAAAACTTGAGCTTGGCTCGGCT[C/T]
GTTTCCTGGCTCGAGCTAGCTCGAACTGGCTTGCAAGCCTTCATGTTAAAACATTTCTTCATATATATTTTGTAACTATTAAAAAAAGTAAGAATAAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.40% 10.20% 0.02% 1.42% NA
All Indica  2759 94.80% 5.10% 0.04% 0.04% NA
All Japonica  1512 95.30% 0.50% 0.00% 4.23% NA
Aus  269 11.20% 88.80% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 93.40% 6.50% 0.00% 0.11% NA
Indica Intermediate  786 91.60% 8.30% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 90.90% 0.20% 0.00% 8.93% NA
Japonica Intermediate  241 89.60% 2.50% 0.00% 7.88% NA
VI/Aromatic  96 17.70% 80.20% 0.00% 2.08% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821671221 G -> A LOC_Os08g34530.1 downstream_gene_variant ; 1392.0bp to feature; MODIFIER silent_mutation Average:74.098; most accessible tissue: Callus, score: 89.756 N N N N
vg0821671221 G -> A LOC_Os08g34520-LOC_Os08g34530 intergenic_region ; MODIFIER silent_mutation Average:74.098; most accessible tissue: Callus, score: 89.756 N N N N
vg0821671221 G -> DEL N N silent_mutation Average:74.098; most accessible tissue: Callus, score: 89.756 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0821671221 G A 0.01 -0.01 -0.01 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0821671221 NA 5.14E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821671221 NA 3.10E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821671221 NA 3.19E-22 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821671221 NA 1.16E-26 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821671221 NA 1.10E-12 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821671221 NA 2.23E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821671221 NA 3.03E-25 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821671221 NA 3.22E-22 mr1765 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821671221 NA 2.85E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821671221 NA 6.08E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821671221 NA 3.98E-23 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821671221 NA 4.11E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821671221 NA 4.35E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821671221 NA 6.91E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251