\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821655390:

Variant ID: vg0821655390 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 21655390
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCTACACGTTTATGAAGAGATATAGGCCCTCTTTGTTTAGGCTTAGGCTTATTGGCTTAAACTTTTAATTCAGCTTATTGGCTTATATGATTTATAAG[C/T,A]
CGGTGGATTTAATGTCCTAAGTTTAGTGGTTGAGTCATACATCTACCTCATATAAGCCAAAAAAGCTTCTCCAACCTAGCTTTTGGCTGAATAGTGTTAG

Reverse complement sequence

CTAACACTATTCAGCCAAAAGCTAGGTTGGAGAAGCTTTTTTGGCTTATATGAGGTAGATGTATGACTCAACCACTAAACTTAGGACATTAAATCCACCG[G/A,T]
CTTATAAATCATATAAGCCAATAAGCTGAATTAAAAGTTTAAGCCAATAAGCCTAAGCCTAAACAAAGAGGGCCTATATCTCTTCATAAACGTGTAGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 8.30% 3.83% 0.00% A: 0.02%
All Indica  2759 79.50% 14.10% 6.34% 0.00% NA
All Japonica  1512 99.70% 0.00% 0.26% 0.00% A: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 69.10% 16.00% 14.96% 0.00% NA
Indica II  465 95.10% 2.80% 2.15% 0.00% NA
Indica III  913 81.10% 18.20% 0.77% 0.00% NA
Indica Intermediate  786 76.50% 14.80% 8.78% 0.00% NA
Temperate Japonica  767 99.30% 0.00% 0.52% 0.00% A: 0.13%
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821655390 C -> T LOC_Os08g34510.1 upstream_gene_variant ; 1294.0bp to feature; MODIFIER silent_mutation Average:33.898; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0821655390 C -> T LOC_Os08g34510-LOC_Os08g34520 intergenic_region ; MODIFIER silent_mutation Average:33.898; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0821655390 C -> A LOC_Os08g34510.1 upstream_gene_variant ; 1294.0bp to feature; MODIFIER silent_mutation Average:33.898; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0821655390 C -> A LOC_Os08g34510-LOC_Os08g34520 intergenic_region ; MODIFIER silent_mutation Average:33.898; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0821655390 NA 1.41E-11 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821655390 NA 3.05E-07 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821655390 NA 8.20E-12 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821655390 NA 1.66E-07 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821655390 NA 1.59E-13 mr1860 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821655390 NA 9.02E-09 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821655390 NA 6.09E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821655390 NA 6.12E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821655390 NA 7.29E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821655390 NA 2.62E-12 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821655390 NA 2.30E-06 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821655390 NA 7.76E-10 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821655390 NA 2.21E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821655390 NA 3.47E-06 mr1954_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821655390 NA 2.99E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251