Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821385931:

Variant ID: vg0821385931 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 21385931
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTCAAGCTTCTGAGCACTAGAATTTTCATTTAAACAAATCTTCATTAGTACTTCCTCCGTATACTCCCTCCGGATTTTAATATTTTAATATATGACAC[T/C]
ATTGCTTTTTTAACCAACGTTTGATCATTTATTTTATTCAAAATTTTTTTTCAAATATAAAAATATTTATGTTATGCTTAAAAGAACATTTAATGATGAA

Reverse complement sequence

TTCATCATTAAATGTTCTTTTAAGCATAACATAAATATTTTTATATTTGAAAAAAAATTTTGAATAAAATAAATGATCAAACGTTGGTTAAAAAAGCAAT[A/G]
GTGTCATATATTAAAATATTAAAATCCGGAGGGAGTATACGGAGGAAGTACTAATGAAGATTTGTTTAAATGAAAATTCTAGTGCTCAGAAGCTTGAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.60%	21.30%	0.06%	0.00%	NA
All Indica	2759	99.30%	0.70%	0.07%	0.00%	NA
All Japonica	1512	37.30%	62.60%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.40%	0.25%	0.00%	NA
Temperate Japonica	767	3.90%	96.10%	0.00%	0.00%	NA
Tropical Japonica	504	82.90%	17.10%	0.00%	0.00%	NA
Japonica Intermediate	241	48.10%	51.50%	0.41%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0821385931	T -> C	LOC_Os08g34100.1	upstream_gene_variant ; 3927.0bp to feature; MODIFIER	silent_mutation	Average:48.85; most accessible tissue: Callus, score: 79.027	N	N	N	N
vg0821385931	T -> C	LOC_Os08g34110.1	downstream_gene_variant ; 1987.0bp to feature; MODIFIER	silent_mutation	Average:48.85; most accessible tissue: Callus, score: 79.027	N	N	N	N
vg0821385931	T -> C	LOC_Os08g34100-LOC_Os08g34110	intergenic_region ; MODIFIER	silent_mutation	Average:48.85; most accessible tissue: Callus, score: 79.027	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0821385931	NA	2.84E-17	mr1308	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	1.48E-06	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	5.30E-08	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	1.45E-11	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	2.63E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	2.86E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	8.49E-36	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	8.06E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	1.84E-06	5.42E-09	mr1806	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	7.80E-32	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	5.84E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	4.51E-13	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	7.91E-14	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	6.69E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	4.14E-39	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	2.64E-10	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	4.32E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385931	NA	2.08E-18	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251