\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821385042:

Variant ID: vg0821385042 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 21385042
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GTTAGCTTGGTGTGGTAAAAAAAAAACTTTAACACGCCACATACAGTGGGTGCGATAGTTTTGTCCAGTCACGCCAATAAGGATGATGTGGACAAATAAT[G/A]
TTATCACGTCAGGCAGTCCAGCGTGCCAAATAACGATATGACAAACAAACCGACGTGGTATTGATGTTGTTTATTGTTGTTTTGCCACGCCAATTTGGCT

Reverse complement sequence

AGCCAAATTGGCGTGGCAAAACAACAATAAACAACATCAATACCACGTCGGTTTGTTTGTCATATCGTTATTTGGCACGCTGGACTGCCTGACGTGATAA[C/T]
ATTATTTGTCCACATCATCCTTATTGGCGTGACTGGACAAAACTATCGCACCCACTGTATGTGGCGTGTTAAAGTTTTTTTTTTACCACACCAAGCTAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.10% 11.80% 7.13% 0.00% NA
All Indica  2759 68.50% 19.40% 12.11% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 52.60% 16.80% 30.59% 0.00% NA
Indica II  465 26.70% 58.90% 14.41% 0.00% NA
Indica III  913 98.70% 0.20% 1.10% 0.00% NA
Indica Intermediate  786 70.10% 20.40% 9.54% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821385042 G -> A LOC_Os08g34100.1 upstream_gene_variant ; 3038.0bp to feature; MODIFIER silent_mutation Average:67.255; most accessible tissue: Callus, score: 89.24 N N N N
vg0821385042 G -> A LOC_Os08g34110.1 downstream_gene_variant ; 2876.0bp to feature; MODIFIER silent_mutation Average:67.255; most accessible tissue: Callus, score: 89.24 N N N N
vg0821385042 G -> A LOC_Os08g34100-LOC_Os08g34110 intergenic_region ; MODIFIER silent_mutation Average:67.255; most accessible tissue: Callus, score: 89.24 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0821385042 NA 3.91E-08 mr1699 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385042 NA 2.22E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385042 NA 1.99E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385042 NA 8.35E-07 mr1469_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385042 NA 5.27E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385042 NA 4.84E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821385042 NA 2.98E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251