\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821309836:

Variant ID: vg0821309836 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 21309836
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGAAACCTACTACTTCCTCCGTCCTAAAATGAAACCATTTTTAAGGTTGGCACGGTATTAAGAAAGTATATGAGAATGATTGGAGGAAGTGTGTGATT[A/G]
GTTGAAAAGAGAAAGTAAGTGAAGAAGAATGGTTGTGATTGGTTGAGAGGAGGAGGTAGGTGAAGAAATAGCTTCATTTTGGGACAAGACACTACTAGAA

Reverse complement sequence

TTCTAGTAGTGTCTTGTCCCAAAATGAAGCTATTTCTTCACCTACCTCCTCCTCTCAACCAATCACAACCATTCTTCTTCACTTACTTTCTCTTTTCAAC[T/C]
AATCACACACTTCCTCCAATCATTCTCATATACTTTCTTAATACCGTGCCAACCTTAAAAATGGTTTCATTTTAGGACGGAGGAAGTAGTAGGTTTCTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.00% 22.90% 0.04% 0.00% NA
All Indica  2759 99.20% 0.80% 0.00% 0.00% NA
All Japonica  1512 32.50% 67.50% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 71.60% 28.40% 0.00% 0.00% NA
Japonica Intermediate  241 41.90% 57.70% 0.41% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821309836 A -> G LOC_Os08g34010.1 upstream_gene_variant ; 787.0bp to feature; MODIFIER silent_mutation Average:51.265; most accessible tissue: Zhenshan97 panicle, score: 96.087 N N N N
vg0821309836 A -> G LOC_Os08g34020.1 upstream_gene_variant ; 4727.0bp to feature; MODIFIER silent_mutation Average:51.265; most accessible tissue: Zhenshan97 panicle, score: 96.087 N N N N
vg0821309836 A -> G LOC_Os08g34020.2 upstream_gene_variant ; 4727.0bp to feature; MODIFIER silent_mutation Average:51.265; most accessible tissue: Zhenshan97 panicle, score: 96.087 N N N N
vg0821309836 A -> G LOC_Os08g34010-LOC_Os08g34020 intergenic_region ; MODIFIER silent_mutation Average:51.265; most accessible tissue: Zhenshan97 panicle, score: 96.087 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0821309836 A G -0.02 -0.02 -0.01 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0821309836 NA 1.91E-55 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821309836 NA 6.24E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821309836 NA 9.12E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821309836 NA 4.35E-73 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821309836 NA 3.64E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821309836 NA 3.63E-30 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821309836 NA 3.01E-69 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821309836 NA 2.10E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821309836 NA 2.06E-52 mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821309836 NA 7.38E-75 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821309836 NA 1.30E-37 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821309836 4.83E-06 5.82E-12 mr1660_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821309836 NA 4.59E-75 mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821309836 NA 2.45E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251