\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821189139:

Variant ID: vg0821189139 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 21189139
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.09, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTCTTCCTCCTCGAATATGAACCCGTTGAGATCAGAGATGGCGCTAGATCCCTCTTACCGGTCTCCATAGGTACCGGATTGGGTTTGTCTAGACTAAT[A/C]
TCTGATATTGACGTTTGGCGGCGTATTGGCTTGTGTATTGTGGCTTTATGGTTTGTCCCTTCTTCTTTTAGGGGGTCTTGTATTTATACCCATAGATAAC

Reverse complement sequence

GTTATCTATGGGTATAAATACAAGACCCCCTAAAAGAAGAAGGGACAAACCATAAAGCCACAATACACAAGCCAATACGCCGCCAAACGTCAATATCAGA[T/G]
ATTAGTCTAGACAAACCCAATCCGGTACCTATGGAGACCGGTAAGAGGGATCTAGCGCCATCTCTGATCTCAACGGGTTCATATTCGAGGAGGAAGACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.80% 24.90% 0.61% 0.70% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 22.60% 73.50% 1.72% 2.18% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 3.80% 95.60% 0.52% 0.13% NA
Tropical Japonica  504 48.80% 40.70% 4.37% 6.15% NA
Japonica Intermediate  241 27.40% 72.20% 0.00% 0.41% NA
VI/Aromatic  96 80.20% 18.80% 1.04% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821189139 A -> C LOC_Os08g33840.1 upstream_gene_variant ; 2581.0bp to feature; MODIFIER silent_mutation Average:70.816; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg0821189139 A -> C LOC_Os08g33850.1 upstream_gene_variant ; 1068.0bp to feature; MODIFIER silent_mutation Average:70.816; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg0821189139 A -> C LOC_Os08g33850.2 upstream_gene_variant ; 1068.0bp to feature; MODIFIER silent_mutation Average:70.816; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg0821189139 A -> C LOC_Os08g33840-LOC_Os08g33850 intergenic_region ; MODIFIER silent_mutation Average:70.816; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg0821189139 A -> DEL N N silent_mutation Average:70.816; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0821189139 NA 7.23E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 2.88E-33 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 8.10E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 5.60E-06 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 8.38E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 3.63E-10 3.70E-15 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 2.01E-17 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 4.27E-39 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 5.15E-44 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 3.27E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 1.58E-20 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 1.15E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 3.40E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 2.14E-17 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 1.60E-12 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 1.23E-36 mr1980 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 9.10E-11 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 1.60E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 8.74E-70 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 9.62E-06 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 2.44E-11 6.98E-16 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 3.98E-19 mr1410_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 4.62E-43 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 1.66E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 1.90E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 5.24E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 4.19E-22 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139 NA 1.67E-17 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251