Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821189139:

Variant ID: vg0821189139 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 21189139
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.09, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTCTTCCTCCTCGAATATGAACCCGTTGAGATCAGAGATGGCGCTAGATCCCTCTTACCGGTCTCCATAGGTACCGGATTGGGTTTGTCTAGACTAAT[A/C]
TCTGATATTGACGTTTGGCGGCGTATTGGCTTGTGTATTGTGGCTTTATGGTTTGTCCCTTCTTCTTTTAGGGGGTCTTGTATTTATACCCATAGATAAC

Reverse complement sequence

GTTATCTATGGGTATAAATACAAGACCCCCTAAAAGAAGAAGGGACAAACCATAAAGCCACAATACACAAGCCAATACGCCGCCAAACGTCAATATCAGA[T/G]
ATTAGTCTAGACAAACCCAATCCGGTACCTATGGAGACCGGTAAGAGGGATCTAGCGCCATCTCTGATCTCAACGGGTTCATATTCGAGGAGGAAGACTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.80%	24.90%	0.61%	0.70%	NA
All Indica	2759	99.30%	0.70%	0.00%	0.00%	NA
All Japonica	1512	22.60%	73.50%	1.72%	2.18%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	3.80%	95.60%	0.52%	0.13%	NA
Tropical Japonica	504	48.80%	40.70%	4.37%	6.15%	NA
Japonica Intermediate	241	27.40%	72.20%	0.00%	0.41%	NA
VI/Aromatic	96	80.20%	18.80%	1.04%	0.00%	NA
Intermediate	90	70.00%	28.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0821189139	A -> C	LOC_Os08g33840.1	upstream_gene_variant ; 2581.0bp to feature; MODIFIER	silent_mutation	Average:70.816; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg0821189139	A -> C	LOC_Os08g33850.1	upstream_gene_variant ; 1068.0bp to feature; MODIFIER	silent_mutation	Average:70.816; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg0821189139	A -> C	LOC_Os08g33850.2	upstream_gene_variant ; 1068.0bp to feature; MODIFIER	silent_mutation	Average:70.816; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg0821189139	A -> C	LOC_Os08g33840-LOC_Os08g33850	intergenic_region ; MODIFIER	silent_mutation	Average:70.816; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg0821189139	A -> DEL	N	N	silent_mutation	Average:70.816; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0821189139	NA	7.23E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	2.88E-33	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	8.10E-07	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	5.60E-06	NA	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	8.38E-06	mr1404	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	3.63E-10	3.70E-15	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	2.01E-17	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	4.27E-39	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	5.15E-44	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	3.27E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	1.58E-20	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	1.15E-08	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	3.40E-09	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	2.14E-17	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	1.60E-12	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	1.23E-36	mr1980	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	9.10E-11	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	1.60E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	8.74E-70	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	9.62E-06	NA	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	2.44E-11	6.98E-16	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	3.98E-19	mr1410_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	4.62E-43	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	1.66E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	1.90E-08	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	5.24E-06	mr1668_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	4.19E-22	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821189139	NA	1.67E-17	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251