\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821161332:

Variant ID: vg0821161332 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 21161332
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 359. )

Flanking Sequence (100 bp) in Reference Genome:


GGGCTTGTCTCTTTTGTAGAGGGAGAGAGAATTAGCTAACATACAACTGTTCCAACTGATTCTTGTTTTTGGATCGAGTATAGTTTAATTGTGCTGGAAT[C/T]
ATTCGTGATTAGGTAGCTAATGGGGTACTATACTGCTGATCATGAGAAGATTTTTGGTTTCTTTTACAGCCTTTTTGAGAAAAAACACAGGTAGGGAACA

Reverse complement sequence

TGTTCCCTACCTGTGTTTTTTCTCAAAAAGGCTGTAAAAGAAACCAAAAATCTTCTCATGATCAGCAGTATAGTACCCCATTAGCTACCTAATCACGAAT[G/A]
ATTCCAGCACAATTAAACTATACTCGATCCAAAAACAAGAATCAGTTGGAACAGTTGTATGTTAGCTAATTCTCTCTCCCTCTACAAAAGAGACAAGCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.70% 11.70% 3.51% 0.00% NA
All Indica  2759 74.70% 19.40% 5.87% 0.00% NA
All Japonica  1512 99.20% 0.70% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 70.80% 17.10% 12.10% 0.00% NA
Indica II  465 28.80% 60.90% 10.32% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 75.80% 19.00% 5.22% 0.00% NA
Temperate Japonica  767 99.00% 0.90% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 10.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821161332 C -> T LOC_Os08g33800.1 downstream_gene_variant ; 3557.0bp to feature; MODIFIER silent_mutation Average:76.004; most accessible tissue: Minghui63 flower, score: 92.477 N N N N
vg0821161332 C -> T LOC_Os08g33810.1 downstream_gene_variant ; 3674.0bp to feature; MODIFIER silent_mutation Average:76.004; most accessible tissue: Minghui63 flower, score: 92.477 N N N N
vg0821161332 C -> T LOC_Os08g33800-LOC_Os08g33810 intergenic_region ; MODIFIER silent_mutation Average:76.004; most accessible tissue: Minghui63 flower, score: 92.477 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0821161332 C T -0.05 0.01 0.0 0.0 -0.05 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0821161332 NA 3.94E-06 mr1194_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 3.67E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 1.55E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 4.70E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 2.67E-09 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 7.82E-06 mr1302_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 2.25E-06 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 3.81E-07 mr1469_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 6.90E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 1.10E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 6.84E-07 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 1.42E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 7.62E-06 5.35E-10 mr1539_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 6.19E-09 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 6.26E-06 mr1553_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 1.46E-07 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 3.79E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 4.77E-08 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 9.09E-07 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821161332 NA 4.91E-07 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251