Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821145417:

Variant ID: vg0821145417 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 21145417
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


AACTGTAAGACGAATTTATTAAGCCTAATTAATCTATCATTAGCAAATGTTTACTGTAGCATCACATTGTCAAATCATAGCACAATTAGACTTAAGAAAA[T/A]
TTGTCTCGCAATTTACATGCAAACTGAGCAATTTGTTTTTTTTTCTATATTTAGTGTTGTAGCGTCCGTTCCGTCGTGGCGCCTAGCGGGAAAATTATCT

Reverse complement sequence

AGATAATTTTCCCGCTAGGCGCCACGACGGAACGGACGCTACAACACTAAATATAGAAAAAAAAACAAATTGCTCAGTTTGCATGTAAATTGCGAGACAA[A/T]
TTTTCTTAAGTCTAATTGTGCTATGATTTGACAATGTGATGCTACAGTAAACATTTGCTAATGATAGATTAATTAGGCTTAATAAATTCGTCTTACAGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 37.00% 0.11% 0.02% NA
All Indica  2759 95.70% 4.20% 0.07% 0.00% NA
All Japonica  1512 1.90% 97.90% 0.20% 0.00% NA
Aus  269 94.10% 5.90% 0.00% 0.00% NA
Indica I  595 97.10% 2.90% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 95.30% 4.70% 0.00% 0.00% NA
Indica Intermediate  786 94.70% 5.10% 0.25% 0.00% NA
Temperate Japonica  767 1.30% 98.60% 0.13% 0.00% NA
Tropical Japonica  504 2.20% 97.60% 0.20% 0.00% NA
Japonica Intermediate  241 2.90% 96.70% 0.41% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821145417 T -> A LOC_Os08g33790-LOC_Os08g33800 intergenic_region ; MODIFIER silent_mutation Average:32.846; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0821145417 T -> DEL N N silent_mutation Average:32.846; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0821145417 NA 3.53E-102 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 1.66E-101 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 4.58E-72 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 5.08E-27 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 4.45E-82 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 1.16E-79 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 1.33E-86 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 8.09E-22 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 4.82E-06 7.27E-06 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 2.53E-36 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 4.21E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 5.28E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 1.25E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 9.99E-74 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 6.90E-14 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 7.23E-08 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 NA 2.92E-86 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821145417 5.49E-07 NA mr1588_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251