| Variant ID: vg0821145417 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 21145417 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 74. )
AACTGTAAGACGAATTTATTAAGCCTAATTAATCTATCATTAGCAAATGTTTACTGTAGCATCACATTGTCAAATCATAGCACAATTAGACTTAAGAAAA[T/A]
TTGTCTCGCAATTTACATGCAAACTGAGCAATTTGTTTTTTTTTCTATATTTAGTGTTGTAGCGTCCGTTCCGTCGTGGCGCCTAGCGGGAAAATTATCT
AGATAATTTTCCCGCTAGGCGCCACGACGGAACGGACGCTACAACACTAAATATAGAAAAAAAAACAAATTGCTCAGTTTGCATGTAAATTGCGAGACAA[A/T]
TTTTCTTAAGTCTAATTGTGCTATGATTTGACAATGTGATGCTACAGTAAACATTTGCTAATGATAGATTAATTAGGCTTAATAAATTCGTCTTACAGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.90% | 37.00% | 0.11% | 0.02% | NA |
| All Indica | 2759 | 95.70% | 4.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 1.90% | 97.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.70% | 5.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 98.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 2.20% | 97.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 96.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 56.70% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0821145417 | T -> A | LOC_Os08g33790-LOC_Os08g33800 | intergenic_region ; MODIFIER | silent_mutation | Average:32.846; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0821145417 | T -> DEL | N | N | silent_mutation | Average:32.846; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0821145417 | NA | 3.53E-102 | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821145417 | NA | 1.66E-101 | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821145417 | NA | 4.58E-72 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821145417 | NA | 5.08E-27 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821145417 | NA | 4.45E-82 | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821145417 | NA | 1.16E-79 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821145417 | NA | 1.33E-86 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821145417 | NA | 8.09E-22 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821145417 | 4.82E-06 | 7.27E-06 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821145417 | NA | 2.53E-36 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/