\
| Variant ID: vg0821141087 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 21141087 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCGGCGAAGGGGTAAGTTCTACGTTCCGCCAGCCTTGGTGAATCTATTAGCTAAATGGTGTTGTTCAAGGCTGCATCACTTCGATCTCTTGGATCGCTCT[A/G]
GTTTGGTTGATATATTTGCCTATCTGATATCTAAATTCTATCTCTAATTGCATTGTGTTTAGAGACGCATCGGTTTAGTCGGGACTGTCTCGGTTAGGTC
GACCTAACCGAGACAGTCCCGACTAAACCGATGCGTCTCTAAACACAATGCAATTAGAGATAGAATTTAGATATCAGATAGGCAAATATATCAACCAAAC[T/C]
AGAGCGATCCAAGAGATCGAAGTGATGCAGCCTTGAACAACACCATTTAGCTAATAGATTCACCAAGGCTGGCGGAACGTAGAACTTACCCCTTCGCCGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.90% | 27.90% | 0.13% | 0.13% | NA |
| All Indica | 2759 | 98.80% | 0.80% | 0.18% | 0.18% | NA |
| All Japonica | 1512 | 22.50% | 77.40% | 0.07% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.00% | 0.17% | 0.50% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.00% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 98.20% | 1.30% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 3.80% | 96.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 48.80% | 51.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 27.00% | 72.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 44.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0821141087 | A -> G | LOC_Os08g33790.1 | upstream_gene_variant ; 4901.0bp to feature; MODIFIER | silent_mutation | Average:45.197; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0821141087 | A -> G | LOC_Os08g33790-LOC_Os08g33800 | intergenic_region ; MODIFIER | silent_mutation | Average:45.197; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0821141087 | A -> DEL | N | N | silent_mutation | Average:45.197; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0821141087 | 5.95E-06 | NA | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821141087 | 8.71E-13 | 2.08E-18 | mr1410 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821141087 | NA | 3.52E-16 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821141087 | NA | 1.76E-30 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821141087 | NA | 9.48E-10 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821141087 | 6.03E-11 | 4.83E-17 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821141087 | NA | 8.35E-16 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821141087 | NA | 1.75E-08 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |