Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821112264:

Variant ID: vg0821112264 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 21112264
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTATTTTTAATTGTATTTATATATAAACGTATCTTTCGATATTCTTTTTTTTATTTCACTTACTTCTAAATTGTATTTCTATATGAACTCTAGACTCTT[T/C]
TTTCAATATTTATTAATTTTTAATTTTATTTATTTCTATGTTGTATTTCTATATAGACTCTAAACGCTACTTTTAATCTTTTATTTTTATTCCGAATTTG

Reverse complement sequence

CAAATTCGGAATAAAAATAAAAGATTAAAAGTAGCGTTTAGAGTCTATATAGAAATACAACATAGAAATAAATAAAATTAAAAATTAATAAATATTGAAA[A/G]
AAGAGTCTAGAGTTCATATAGAAATACAATTTAGAAGTAAGTGAAATAAAAAAAAGAATATCGAAAGATACGTTTATATATAAATACAATTAAAAATAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.30%	27.90%	2.31%	1.54%	NA
All Indica	2759	92.60%	1.20%	3.59%	2.61%	NA
All Japonica	1512	22.90%	76.90%	0.26%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	89.90%	0.50%	6.89%	2.69%	NA
Indica II	465	86.20%	0.90%	6.67%	6.24%	NA
Indica III	913	98.50%	1.40%	0.00%	0.11%	NA
Indica Intermediate	786	91.70%	1.50%	3.44%	3.31%	NA
Temperate Japonica	767	3.90%	95.80%	0.26%	0.00%	NA
Tropical Japonica	504	48.60%	51.40%	0.00%	0.00%	NA
Japonica Intermediate	241	29.50%	69.70%	0.83%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	51.10%	42.20%	5.56%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0821112264	T -> C	LOC_Os08g33760.1	upstream_gene_variant ; 4100.0bp to feature; MODIFIER	silent_mutation	Average:16.189; most accessible tissue: Callus, score: 37.968	N	N	N	N
vg0821112264	T -> C	LOC_Os08g33750-LOC_Os08g33760	intergenic_region ; MODIFIER	silent_mutation	Average:16.189; most accessible tissue: Callus, score: 37.968	N	N	N	N
vg0821112264	T -> DEL	N	N	silent_mutation	Average:16.189; most accessible tissue: Callus, score: 37.968	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0821112264	NA	1.49E-09	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821112264	1.78E-07	NA	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821112264	1.83E-12	1.86E-18	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821112264	NA	4.82E-16	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821112264	NA	7.83E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821112264	NA	6.31E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821112264	NA	2.58E-08	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821112264	NA	5.20E-09	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821112264	9.69E-07	NA	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821112264	1.28E-11	1.65E-17	mr1410_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821112264	NA	1.30E-16	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821112264	NA	2.20E-08	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821112264	NA	3.49E-06	mr1668_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821112264	NA	3.60E-21	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821112264	NA	1.84E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251