\
| Variant ID: vg0821112264 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 21112264 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTATTTTTAATTGTATTTATATATAAACGTATCTTTCGATATTCTTTTTTTTATTTCACTTACTTCTAAATTGTATTTCTATATGAACTCTAGACTCTT[T/C]
TTTCAATATTTATTAATTTTTAATTTTATTTATTTCTATGTTGTATTTCTATATAGACTCTAAACGCTACTTTTAATCTTTTATTTTTATTCCGAATTTG
CAAATTCGGAATAAAAATAAAAGATTAAAAGTAGCGTTTAGAGTCTATATAGAAATACAACATAGAAATAAATAAAATTAAAAATTAATAAATATTGAAA[A/G]
AAGAGTCTAGAGTTCATATAGAAATACAATTTAGAAGTAAGTGAAATAAAAAAAAGAATATCGAAAGATACGTTTATATATAAATACAATTAAAAATAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.30% | 27.90% | 2.31% | 1.54% | NA |
| All Indica | 2759 | 92.60% | 1.20% | 3.59% | 2.61% | NA |
| All Japonica | 1512 | 22.90% | 76.90% | 0.26% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 89.90% | 0.50% | 6.89% | 2.69% | NA |
| Indica II | 465 | 86.20% | 0.90% | 6.67% | 6.24% | NA |
| Indica III | 913 | 98.50% | 1.40% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 91.70% | 1.50% | 3.44% | 3.31% | NA |
| Temperate Japonica | 767 | 3.90% | 95.80% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 48.60% | 51.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 29.50% | 69.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 42.20% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0821112264 | T -> C | LOC_Os08g33760.1 | upstream_gene_variant ; 4100.0bp to feature; MODIFIER | silent_mutation | Average:16.189; most accessible tissue: Callus, score: 37.968 | N | N | N | N |
| vg0821112264 | T -> C | LOC_Os08g33750-LOC_Os08g33760 | intergenic_region ; MODIFIER | silent_mutation | Average:16.189; most accessible tissue: Callus, score: 37.968 | N | N | N | N |
| vg0821112264 | T -> DEL | N | N | silent_mutation | Average:16.189; most accessible tissue: Callus, score: 37.968 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0821112264 | NA | 1.49E-09 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821112264 | 1.78E-07 | NA | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821112264 | 1.83E-12 | 1.86E-18 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821112264 | NA | 4.82E-16 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821112264 | NA | 7.83E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821112264 | NA | 6.31E-07 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821112264 | NA | 2.58E-08 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821112264 | NA | 5.20E-09 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821112264 | 9.69E-07 | NA | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821112264 | 1.28E-11 | 1.65E-17 | mr1410_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821112264 | NA | 1.30E-16 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821112264 | NA | 2.20E-08 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821112264 | NA | 3.49E-06 | mr1668_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821112264 | NA | 3.60E-21 | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821112264 | NA | 1.84E-08 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |