\
| Variant ID: vg0821086229 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 21086229 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 340. )
CAGAATAAGGTAGTCATTGATGGAACTGACATGCAGAATTACGAGAAATCATGTGCAAATGAAGCTGCTCTCCTGCACATATCAAGTTCGGAACAAAATT[C/T]
AACACGGATCATTCTTCTCGTCAGTCTTGGTCAGATTTGATCCAATCATTCTTTGCTGCCAAAAAGGGCGTGGAAATAACACCGTCATTCTTTCAACAAT
ATTGTTGAAAGAATGACGGTGTTATTTCCACGCCCTTTTTGGCAGCAAAGAATGATTGGATCAAATCTGACCAAGACTGACGAGAAGAATGATCCGTGTT[G/A]
AATTTTGTTCCGAACTTGATATGTGCAGGAGAGCAGCTTCATTTGCACATGATTTCTCGTAATTCTGCATGTCAGTTCCATCAATGACTACCTTATTCTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.00% | 3.50% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 88.30% | 10.50% | 1.19% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 75.20% | 22.60% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.20% | 13.30% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0821086229 | C -> T | LOC_Os08g33740.1 | 3_prime_UTR_variant ; 102.0bp to feature; MODIFIER | silent_mutation | Average:60.167; most accessible tissue: Callus, score: 88.886 | N | N | N | N |
| vg0821086229 | C -> T | LOC_Os08g33750.1 | downstream_gene_variant ; 3713.0bp to feature; MODIFIER | silent_mutation | Average:60.167; most accessible tissue: Callus, score: 88.886 | N | N | N | N |
| vg0821086229 | C -> T | LOC_Os08g33750.2 | downstream_gene_variant ; 3713.0bp to feature; MODIFIER | silent_mutation | Average:60.167; most accessible tissue: Callus, score: 88.886 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0821086229 | NA | 6.84E-07 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821086229 | 9.19E-06 | 9.19E-06 | mr1168 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821086229 | NA | 2.07E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821086229 | NA | 9.11E-15 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821086229 | 7.29E-07 | 2.79E-16 | mr1410 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821086229 | NA | 4.57E-09 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821086229 | NA | 5.97E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821086229 | NA | 1.95E-09 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821086229 | 3.65E-07 | 2.20E-17 | mr1301_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821086229 | 6.28E-07 | 1.82E-16 | mr1410_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0821086229 | NA | 5.06E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |