\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821086229:

Variant ID: vg0821086229 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 21086229
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 340. )

Flanking Sequence (100 bp) in Reference Genome:


CAGAATAAGGTAGTCATTGATGGAACTGACATGCAGAATTACGAGAAATCATGTGCAAATGAAGCTGCTCTCCTGCACATATCAAGTTCGGAACAAAATT[C/T]
AACACGGATCATTCTTCTCGTCAGTCTTGGTCAGATTTGATCCAATCATTCTTTGCTGCCAAAAAGGGCGTGGAAATAACACCGTCATTCTTTCAACAAT

Reverse complement sequence

ATTGTTGAAAGAATGACGGTGTTATTTCCACGCCCTTTTTGGCAGCAAAGAATGATTGGATCAAATCTGACCAAGACTGACGAGAAGAATGATCCGTGTT[G/A]
AATTTTGTTCCGAACTTGATATGTGCAGGAGAGCAGCTTCATTTGCACATGATTTCTCGTAATTCTGCATGTCAGTTCCATCAATGACTACCTTATTCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 3.50% 0.47% 0.00% NA
All Indica  2759 99.90% 0.10% 0.07% 0.00% NA
All Japonica  1512 88.30% 10.50% 1.19% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 98.20% 1.70% 0.13% 0.00% NA
Tropical Japonica  504 75.20% 22.60% 2.18% 0.00% NA
Japonica Intermediate  241 84.20% 13.30% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821086229 C -> T LOC_Os08g33740.1 3_prime_UTR_variant ; 102.0bp to feature; MODIFIER silent_mutation Average:60.167; most accessible tissue: Callus, score: 88.886 N N N N
vg0821086229 C -> T LOC_Os08g33750.1 downstream_gene_variant ; 3713.0bp to feature; MODIFIER silent_mutation Average:60.167; most accessible tissue: Callus, score: 88.886 N N N N
vg0821086229 C -> T LOC_Os08g33750.2 downstream_gene_variant ; 3713.0bp to feature; MODIFIER silent_mutation Average:60.167; most accessible tissue: Callus, score: 88.886 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0821086229 NA 6.84E-07 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821086229 9.19E-06 9.19E-06 mr1168 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821086229 NA 2.07E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821086229 NA 9.11E-15 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821086229 7.29E-07 2.79E-16 mr1410 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821086229 NA 4.57E-09 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821086229 NA 5.97E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821086229 NA 1.95E-09 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821086229 3.65E-07 2.20E-17 mr1301_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821086229 6.28E-07 1.82E-16 mr1410_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821086229 NA 5.06E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251